Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

FAHD1 cdna clone

FAHD1 cDNA Clone

Gene Names
FAHD1; YISKL; C16orf36
Synonyms
FAHD1; FAHD1 cDNA Clone; FAHD1 cdna clone
Ordering
 
When autocomplete results are available use up and down arrows to review and enter to select. Touch device users, explore by touch or with swipe gestures.
For Research Use Only!
Sequence
atgggaatcatggcagcatccaggccattgtcccgcttctgggagtggggaaagaacatcgtctgcgtggggaggaactacgcggaccacgtcagggagatgcgcagcgcggtgttgagcgagcccgtgctgttcctgaagccgtccacggcctacgcgcccgagggctcgcccatcctcatgcccgcgtacactcgcaacctgcaccacgagctggagctgggcgtggtgatgggcaagcgctgccgcgcagtccccgaggctgcggccatggactacgtgggcggctatgccctgtgcctggatatgaccgcccgggacgtgcaggacgagtgcaagaagaaggggctgccctggactctggcgaagagcttcacggcgtcctgcccggtcagcgcgttcgtgcccaaggagaagatccctgaccctcacaagctgaagctctggctcaaggtcaacggcgaactcagacaggagggtgagacatcctccatgattttttccatcccctacatcatcagctatgtttctaagatcataaccttggaagaaggagatattatcttgactgggacgccaaagggagttggaccggttaaagaaaacgatgagatcgaggctggcatacacgggctgcccaaagtctcctcagcaacacttcctgtgagactacaggaatga
Sequence Length
681
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,128 Da
NCBI Official Full Name
Homo sapiens fumarylacetoacetate hydrolase domain containing 1, mRNA
NCBI Official Synonym Full Names
fumarylacetoacetate hydrolase domain containing 1
NCBI Official Symbol
FAHD1
NCBI Official Synonym Symbols
YISKL; C16orf36
NCBI Protein Information
acylpyruvase FAHD1, mitochondrial
UniProt Protein Name
Acylpyruvase FAHD1, mitochondrial
Protein Family
UniProt Gene Name
FAHD1
UniProt Synonym Gene Names
C16orf36; YISKL; OAA decarboxylase
UniProt Entry Name
FAHD1_HUMAN

Uniprot Description

FAHD1: Probable mitochondrial acylpyruvase which is able to hydrolyze acetylpyruvate and fumarylpyruvate in vitro. Belongs to the FAH family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Mitochondrial; Hydrolase; EC 3.7.1.5

Chromosomal Location of Human Ortholog: 16p13.3

Cellular Component: cytoplasm; cytosol; mitochondrion; nucleoplasm

Molecular Function: acetylpyruvate hydrolase activity; oxaloacetate decarboxylase activity

Research Articles on FAHD1

Similar Products

Product Notes

The FAHD1 fahd1 (Catalog #AAA1269525) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggaatca tggcagcatc caggccattg tcccgcttct gggagtgggg aaagaacatc gtctgcgtgg ggaggaacta cgcggaccac gtcagggaga tgcgcagcgc ggtgttgagc gagcccgtgc tgttcctgaa gccgtccacg gcctacgcgc ccgagggctc gcccatcctc atgcccgcgt acactcgcaa cctgcaccac gagctggagc tgggcgtggt gatgggcaag cgctgccgcg cagtccccga ggctgcggcc atggactacg tgggcggcta tgccctgtgc ctggatatga ccgcccggga cgtgcaggac gagtgcaaga agaaggggct gccctggact ctggcgaaga gcttcacggc gtcctgcccg gtcagcgcgt tcgtgcccaa ggagaagatc cctgaccctc acaagctgaa gctctggctc aaggtcaacg gcgaactcag acaggagggt gagacatcct ccatgatttt ttccatcccc tacatcatca gctatgtttc taagatcata accttggaag aaggagatat tatcttgact gggacgccaa agggagttgg accggttaaa gaaaacgatg agatcgaggc tggcatacac gggctgccca aagtctcctc agcaacactt cctgtgagac tacaggaatg a. It is sometimes possible for the material contained within the vial of "FAHD1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.
Looking for a specific manual?
Request a Manual