FAAH2 cdna clone
FAAH2 cDNA Clone
Gene Names
FAAH2; AMDD
Synonyms
FAAH2; FAAH2 cDNA Clone; FAAH2 cdna clone
Sequence
atggcaccttcatttaccgcccgcattcagttgttcctcttgcgggcgctaggctttctcataggcttagtaggccgagcagctttagtcttagggggtccaaagtttgcctcaaagacccctcggccggtgactgaaccattgcttctgctttcggggatgcagctggccaagctgatccgacagagaaaggtgaaatgtatagatgttgttcaggcttatatcaacagaatcaaggacgtgaacccaatgatcaatggaattgtcaagtacaggtttgaggaagcgatgaaggaggctcatgctgtagatcaaaagcttgcagagaagcaggaagatgaagccaccctggaaaataaatggcccttccttggggttcctttgacagtcaaggaagctttccagctacaaggaatgcccaattcttctggactcatgaaccgtcgtgatgccattgccaaaacagatgccactgtggtggcattactgaagggagctggtgccattcctcttggcataaccaactgtagtgagttgtgtatgtggtatgaatccagtaacaagatctatggccgatcaaacaacccatatgatttacagcatattgtaggtggaagttctggtggtgagggctgcacactggcagctgcctgctcagttattggtgtgggctctgatattggtggtagcattcgaatgcctgctttcttcaatggtatatttggacacaagccttctccaggtgtggttcccaacaaaggtcagtttcccttggctgtgggagcccaggagttgtttctgtgcactggtcctatgtgccgctatgctgaagacctggcccccatgttgaaggtcatggcaggacctgggatcaaaaggttaaaactagacacaaaggtacatttaaaagacttaaaattttactggatggaacatgatggaggctcatttttaatgtccaaagtggaccaagatctcattatgactcagaaaaaggttgtggttcaccttgaaactattctaggagcctcagttcaacatgttaaactgaagaaaatgaagtactcttttcagttgtggatcgcaatgatgtcagcaaagggacatgatgggaaggaacctgtgaaatttgtagatttgcttggtgaccatgggaaacatgtcagtcctctgtgggagttgatcaaatggtgcctgggtctgtcagtgtacaccatcccttccattggactggctttgttggaagaaaagctcagatatagcaatgagaaataccaaaagtttaaggcagtggaagaaagcctgcgtaaagagctggtggatatgctaggtgatgatggtgtgttcttatatccctcacatcccacagtggcacctaagcatcatgtccctctaacacggcccttcaactttgcttacacaggtgtcttcagtgccctgggtttgcctgtgacccaatgcccactgggactgaatgccaaaggactccctttaggcatccaggttgtggctggaccctttaatgatcatctgaccctggctgtggcccagtacttggagaaaacttttgggggctgggtctgtccaggaaagttttag
Sequence Length
1599
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
58,304 Da
NCBI Official Full Name
Homo sapiens fatty acid amide hydrolase 2, mRNA
NCBI Official Synonym Full Names
fatty acid amide hydrolase 2
NCBI Official Symbol
FAAH2
NCBI Official Synonym Symbols
AMDD
NCBI Protein Information
fatty-acid amide hydrolase 2
UniProt Protein Name
Fatty-acid amide hydrolase 2
Protein Family
UniProt Gene Name
FAAH2
UniProt Synonym Gene Names
AMDD
UniProt Entry Name
FAAH2_HUMAN
NCBI Description
This gene encodes a fatty acid amide hydrolase that shares a conserved protein motif with the amidase signature family of enzymes. The encoded enzyme is able to catalyze the hydrolysis of a broad range of bioactive lipids, including those from the three main classes of fatty acid amides; N-acylethanolamines, fatty acid primary amides and N-acyl amino acids. This enzyme has a preference for monounsaturated acyl chains as a substrate.[provided by RefSeq, Sep 2009]
Uniprot Description
FAAH2: Degrades bioactive fatty acid amides like oleamide, the endogenous cannabinoid, anandamide and myristic amide to their corresponding acids, thereby serving to terminate the signaling functions of these molecules. Hydrolyzes monounsaturated substrate anandamide preferentially as compared to polyunsaturated substrates. Belongs to the amidase family.
Protein type: EC 3.5.1.99; Membrane protein, integral; Hydrolase
Chromosomal Location of Human Ortholog: Xp11.21
Cellular Component: lipid particle
Molecular Function: fatty acid amide hydrolase activity
Biological Process: arachidonic acid metabolic process
Research Articles on FAAH2
1. A male patient with neuropsychiatric disorders attributed to a FAAH2 missense mutation is described.
Similar Products
Product Notes
The FAAH2 faah2 (Catalog #AAA1277349) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcacctt catttaccgc ccgcattcag ttgttcctct tgcgggcgct aggctttctc ataggcttag taggccgagc agctttagtc ttagggggtc caaagtttgc ctcaaagacc cctcggccgg tgactgaacc attgcttctg ctttcgggga tgcagctggc caagctgatc cgacagagaa aggtgaaatg tatagatgtt gttcaggctt atatcaacag aatcaaggac gtgaacccaa tgatcaatgg aattgtcaag tacaggtttg aggaagcgat gaaggaggct catgctgtag atcaaaagct tgcagagaag caggaagatg aagccaccct ggaaaataaa tggcccttcc ttggggttcc tttgacagtc aaggaagctt tccagctaca aggaatgccc aattcttctg gactcatgaa ccgtcgtgat gccattgcca aaacagatgc cactgtggtg gcattactga agggagctgg tgccattcct cttggcataa ccaactgtag tgagttgtgt atgtggtatg aatccagtaa caagatctat ggccgatcaa acaacccata tgatttacag catattgtag gtggaagttc tggtggtgag ggctgcacac tggcagctgc ctgctcagtt attggtgtgg gctctgatat tggtggtagc attcgaatgc ctgctttctt caatggtata tttggacaca agccttctcc aggtgtggtt cccaacaaag gtcagtttcc cttggctgtg ggagcccagg agttgtttct gtgcactggt cctatgtgcc gctatgctga agacctggcc cccatgttga aggtcatggc aggacctggg atcaaaaggt taaaactaga cacaaaggta catttaaaag acttaaaatt ttactggatg gaacatgatg gaggctcatt tttaatgtcc aaagtggacc aagatctcat tatgactcag aaaaaggttg tggttcacct tgaaactatt ctaggagcct cagttcaaca tgttaaactg aagaaaatga agtactcttt tcagttgtgg atcgcaatga tgtcagcaaa gggacatgat gggaaggaac ctgtgaaatt tgtagatttg cttggtgacc atgggaaaca tgtcagtcct ctgtgggagt tgatcaaatg gtgcctgggt ctgtcagtgt acaccatccc ttccattgga ctggctttgt tggaagaaaa gctcagatat agcaatgaga aataccaaaa gtttaaggca gtggaagaaa gcctgcgtaa agagctggtg gatatgctag gtgatgatgg tgtgttctta tatccctcac atcccacagt ggcacctaag catcatgtcc ctctaacacg gcccttcaac tttgcttaca caggtgtctt cagtgccctg ggtttgcctg tgacccaatg cccactggga ctgaatgcca aaggactccc tttaggcatc caggttgtgg ctggaccctt taatgatcat ctgaccctgg ctgtggccca gtacttggag aaaacttttg ggggctgggt ctgtccagga aagttttag. It is sometimes possible for the material contained within the vial of "FAAH2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
