Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

F2R cdna clone

F2R cDNA Clone

Gene Names
F2R; TR; HTR; CF2R; PAR1; PAR-1
Synonyms
F2R; F2R cDNA Clone; F2R cdna clone
Ordering
For Research Use Only!
Sequence
atggggccgcggcggctgctgctggtggccgcctgcttcagtctgtgcggcccgctgttgtctgcccgcacccgggcccgcaggccagaatcaaaagcaacaaatgccaccttagatccccggtcatttcttctcaggaaccccaatgataaatatgaaccattttgggaggatgaggagaaaaatgaaagtgggttaactgaatacagattagtctccatcaataaaagcagtcctcttcaaaaacaacttcctgcattcatctcagaagatgcctccggatatttgaccagctcctggctgacactctttgtcccatctgtgtacaccggagtgtttgtagtcagcctcccactaaacatcatggccatcgttgtgttcatcctgaaaatgaaggtcaagaagccggcggtggtgtacatgctgcacctggccacggcagatgtgctgtttgtgtctgtgctcccctttaagatcagctattacttttccggcagtgattggcagtttgggtctgaattgtgtcgcttcgtcactgcagcattttactgtaacatgtacgcctctatcttgctcatgacagtcataagcattgaccggtttctggctgtggtgtatcccatgcagtccctctcctggcgtactctgggaagggcttccttcacttgtctggccatctgggctttggccatcgcaggggtagtgcctctgctcctcaaggagcaaaccatccaggtgcccgggctcaacatcactacctgtcatgatgtgctcaatgaaaccctgctcgaaggctactatgcctactacttctcagccttctctgctgtcttcttttttgtgccgctgatcatttccacggtctgttatgtgtctatcattcgatgtcttagctcttccgcagttgccaaccgcagcaagaagtcccgggctttgttcctgtcagctgctgttttctgcatcttcatcatttgcttcggacccacaaacgtcctcctgattgtgcattactcattcctttctcacacttccaccacagaggctgcctactttgcctacctcctctgtgtctgtgtcagcagcataagctgctgcatcgaccccctaatttactattacgcttcctctgagtgccagaggtacgtctacagtatcttatgctgcaaagaaagttccgatcccagcagttataacagcagtgggcagttgatggcaagtaaaatggatacctgctctagtaacctgaataacagcatatacaaaaagctgttaacttag
Sequence Length
1278
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
47,441 Da
NCBI Official Full Name
Homo sapiens coagulation factor II (thrombin) receptor, mRNA
NCBI Official Synonym Full Names
coagulation factor II thrombin receptor
NCBI Official Symbol
F2R
NCBI Official Synonym Symbols
TR; HTR; CF2R; PAR1; PAR-1
NCBI Protein Information
proteinase-activated receptor 1
UniProt Protein Name
Proteinase-activated receptor 1
UniProt Gene Name
F2R
UniProt Synonym Gene Names
CF2R; PAR1; TR; PAR-1
UniProt Entry Name
PAR1_HUMAN

NCBI Description

Coagulation factor II receptor is a 7-transmembrane receptor involved in the regulation of thrombotic response. Proteolytic cleavage leads to the activation of the receptor. F2R is a G-protein coupled receptor family member. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]

Uniprot Description

PAR1: a G-protein coupled high-affinity receptor for activated thrombin or trypsin. Coupled to G proteins that stimulate phosphoinositide hydrolysis. Coupled to G proteins that stimulate phosphoinositide hydrolysis. May play a role in platelet activation and in vascular development.

Protein type: Cell development/differentiation; Membrane protein, integral; GPCR, family 1; Membrane protein, multi-pass; Receptor, GPCR

Chromosomal Location of Human Ortholog: 5q13

Cellular Component: caveola; cell surface; early endosome; extracellular region; Golgi apparatus; integral to plasma membrane; late endosome; neuromuscular junction; plasma membrane; postsynaptic membrane

Molecular Function: G-protein alpha-subunit binding; G-protein beta-subunit binding; G-protein coupled receptor activity; protein binding; receptor binding; thrombin receptor activity

Biological Process: activation of MAPKK activity; anatomical structure morphogenesis; blood coagulation; caspase activation; connective tissue replacement during inflammatory response; elevation of cytosolic calcium ion concentration; elevation of cytosolic calcium ion concentration during G-protein signaling, coupled to IP3 second messenger (phospholipase C activating); establishment of synaptic specificity at neuromuscular junction; G-protein coupled receptor protein signaling pathway; G-protein signaling, coupled to IP3 second messenger (phospholipase C activating); homeostasis of number of cells within a tissue; inflammatory response; negative regulation of cell proliferation; negative regulation of glomerular filtration; negative regulation of neuron apoptosis; platelet activation; platelet dense granule organization and biogenesis; positive regulation of blood coagulation; positive regulation of calcium ion transport; positive regulation of caspase activity; positive regulation of cell migration; positive regulation of cell proliferation; positive regulation of collagen biosynthetic process; positive regulation of I-kappaB kinase/NF-kappaB cascade; positive regulation of JAK-STAT cascade; positive regulation of MAPKKK cascade; positive regulation of phosphoinositide 3-kinase cascade; positive regulation of release of sequestered calcium ion into cytosol; positive regulation of Rho protein signal transduction; positive regulation of smooth muscle contraction; positive regulation of transcription, DNA-dependent; positive regulation of vasoconstriction; protein kinase C activation; regulation of blood coagulation; regulation of interleukin-1 beta production; regulation of sensory perception of pain; release of sequestered calcium ion into cytosol; response to lipopolysaccharide; response to wounding; STAT protein nuclear translocation; tyrosine phosphorylation of STAT protein

Research Articles on F2R

Similar Products

Product Notes

The F2R f2r (Catalog #AAA1268483) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggccgc ggcggctgct gctggtggcc gcctgcttca gtctgtgcgg cccgctgttg tctgcccgca cccgggcccg caggccagaa tcaaaagcaa caaatgccac cttagatccc cggtcatttc ttctcaggaa ccccaatgat aaatatgaac cattttggga ggatgaggag aaaaatgaaa gtgggttaac tgaatacaga ttagtctcca tcaataaaag cagtcctctt caaaaacaac ttcctgcatt catctcagaa gatgcctccg gatatttgac cagctcctgg ctgacactct ttgtcccatc tgtgtacacc ggagtgtttg tagtcagcct cccactaaac atcatggcca tcgttgtgtt catcctgaaa atgaaggtca agaagccggc ggtggtgtac atgctgcacc tggccacggc agatgtgctg tttgtgtctg tgctcccctt taagatcagc tattactttt ccggcagtga ttggcagttt gggtctgaat tgtgtcgctt cgtcactgca gcattttact gtaacatgta cgcctctatc ttgctcatga cagtcataag cattgaccgg tttctggctg tggtgtatcc catgcagtcc ctctcctggc gtactctggg aagggcttcc ttcacttgtc tggccatctg ggctttggcc atcgcagggg tagtgcctct gctcctcaag gagcaaacca tccaggtgcc cgggctcaac atcactacct gtcatgatgt gctcaatgaa accctgctcg aaggctacta tgcctactac ttctcagcct tctctgctgt cttctttttt gtgccgctga tcatttccac ggtctgttat gtgtctatca ttcgatgtct tagctcttcc gcagttgcca accgcagcaa gaagtcccgg gctttgttcc tgtcagctgc tgttttctgc atcttcatca tttgcttcgg acccacaaac gtcctcctga ttgtgcatta ctcattcctt tctcacactt ccaccacaga ggctgcctac tttgcctacc tcctctgtgt ctgtgtcagc agcataagct gctgcatcga ccccctaatt tactattacg cttcctctga gtgccagagg tacgtctaca gtatcttatg ctgcaaagaa agttccgatc ccagcagtta taacagcagt gggcagttga tggcaagtaa aatggatacc tgctctagta acctgaataa cagcatatac aaaaagctgt taacttag. It is sometimes possible for the material contained within the vial of "F2R, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.