Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EYA2 cdna clone

EYA2 cDNA Clone

Gene Names
EYA2; EAB1
Synonyms
EYA2; EYA2 cDNA Clone; EYA2 cdna clone
Ordering
For Research Use Only!
Sequence
atggtagaactagtgatctcacccagcctcactgtaaacagcgattgtctggataaactgaagtttaaccgtgctgacgctgctgtgtggactctgagtgacagacaaggcatcaccaaatcggcccccctgagagtgtcccagctcttctccagatcttgcccacgtgtcctcccccgccagccttccacagccatggcagcctacggccagacgcagtacagtgcggggatccagcaggctaccccctatacagcttacccacctccagcacaagcctatggaatcccttccttcagcacctcacccactggacagagcccatacacctaccagatgcacggcacaacagggttctatcaaggaggaaatggactgggcaacgcagccggtttcgggagtgtgcaccaggactatccttcctaccccggcttcccccagagccagtacccccagtattacggctcatcctacaaccctccctacgtcccggccagcagcatctgcccttcgcccctctccacgtccacctacgtcctccaggaggcatctcacaacgtccccaaccagagttccgagtcacttgctggtgaatacaacacacacaatggaccttccacaccagcgaaagagggagacacagacaggccgcaccgggcctccgacgggaagctccgaggccggtctaagaggagcagtgacccgtccccggcaggggacaatgagattgagcgtgtgttcgtgtgggacttggatgagacaataattatttttcactccttactcacggggacatttgcatccagatacgggaaggacaccacgacgtccgtgcgcattggccttatgatggaagagatgatcttcaaccttgcagatacacatctgttcttcaatgacctggaggattgtgaccagatccacgttgatgacgtctcatcagatgacaatggccaagatttaagcacatacaacttctccgctgacggcttccacagttcggccccagcagccaacctgtgcctgggctctggcgtgcacggcggcgtggactggatgaggaagctggccttccgctaccggcgggtgaaggagatgtacaatacctacaagaacaacgttggtgggttgataggcactcccaaaagggagacctggctacagctccgagctgagctggaagctctcacagacctctggctgacccactccctgaaggcactaaacctcatcaactcccggcccaactgtgtcaatgtgctggtcaccaccactcaactaattcctgccctggccaaagtcctgctatatggcctggggtctgtgtttcctattgagaacatctacagtgcaaccaagacagggaaggagagctgcttcgagaggataatgcagagattcggcagaaaagctgtctacgtggtgatcggtgatggtgtggaagaggagcaaggagcgaaaaagcacaacatgcctttctggcggatatcctgccacgcagacctggaggcactgaggcacgccctggagctggagtatttatag
Sequence Length
1545
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
50,533 Da
NCBI Official Full Name
Homo sapiens eyes absent homolog 2 (Drosophila), mRNA
NCBI Official Synonym Full Names
EYA transcriptional coactivator and phosphatase 2
NCBI Official Symbol
EYA2
NCBI Official Synonym Symbols
EAB1
NCBI Protein Information
eyes absent homolog 2
UniProt Protein Name
Eyes absent homolog 2
Protein Family
UniProt Gene Name
EYA2
UniProt Synonym Gene Names
EAB1
UniProt Entry Name
EYA2_HUMAN

NCBI Description

This gene encodes a member of the eyes absent (EYA) family of proteins. The encoded protein may be post-translationally modified and may play a role in eye development. A similar protein in mice can act as a transcriptional activator. Alternative splicing results in multiple transcript variants, but the full-length natures of all of these variants have not yet been determined. [provided by RefSeq, Jul 2009]

Uniprot Description

EYA2: Tyrosine phosphatase that specifically dephosphorylates 'Tyr-142' of histone H2AX (H2AXY142ph). 'Tyr-142' phosphorylation of histone H2AX plays a central role in DNA repair and acts as a mark that distinguishes between apoptotic and repair responses to genotoxic stress. Promotes efficient DNA repair by dephosphorylating H2AX, promoting the recruitment of DNA repair complexes containing MDC1. Its function as histone phosphatase probably explains its role in transcription regulation during organogenesis. Coactivates SIX1. Seems to coactivate SIX2, SIX4 and SIX5. Together with SIX1 and DACH2 seem to be involved in myogenesis. May be involved in development of the eye. Interaction with GNAZ and GNAI2 prevents nuclear translocation and transcriptional activity. Belongs to the HAD-like hydrolase superfamily. EYA family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Protein phosphatase, tyrosine (non-receptor); EC 3.1.3.48; Cell development/differentiation; Apoptosis

Chromosomal Location of Human Ortholog: 20q13.1

Cellular Component: nucleoplasm

Molecular Function: magnesium ion binding; protein binding; protein tyrosine phosphatase activity

Biological Process: histone dephosphorylation; mesodermal cell fate specification

Research Articles on EYA2

Similar Products

Product Notes

The EYA2 eya2 (Catalog #AAA1272638) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtagaac tagtgatctc acccagcctc actgtaaaca gcgattgtct ggataaactg aagtttaacc gtgctgacgc tgctgtgtgg actctgagtg acagacaagg catcaccaaa tcggcccccc tgagagtgtc ccagctcttc tccagatctt gcccacgtgt cctcccccgc cagccttcca cagccatggc agcctacggc cagacgcagt acagtgcggg gatccagcag gctaccccct atacagctta cccacctcca gcacaagcct atggaatccc ttccttcagc acctcaccca ctggacagag cccatacacc taccagatgc acggcacaac agggttctat caaggaggaa atggactggg caacgcagcc ggtttcggga gtgtgcacca ggactatcct tcctaccccg gcttccccca gagccagtac ccccagtatt acggctcatc ctacaaccct ccctacgtcc cggccagcag catctgccct tcgcccctct ccacgtccac ctacgtcctc caggaggcat ctcacaacgt ccccaaccag agttccgagt cacttgctgg tgaatacaac acacacaatg gaccttccac accagcgaaa gagggagaca cagacaggcc gcaccgggcc tccgacggga agctccgagg ccggtctaag aggagcagtg acccgtcccc ggcaggggac aatgagattg agcgtgtgtt cgtgtgggac ttggatgaga caataattat ttttcactcc ttactcacgg ggacatttgc atccagatac gggaaggaca ccacgacgtc cgtgcgcatt ggccttatga tggaagagat gatcttcaac cttgcagata cacatctgtt cttcaatgac ctggaggatt gtgaccagat ccacgttgat gacgtctcat cagatgacaa tggccaagat ttaagcacat acaacttctc cgctgacggc ttccacagtt cggccccagc agccaacctg tgcctgggct ctggcgtgca cggcggcgtg gactggatga ggaagctggc cttccgctac cggcgggtga aggagatgta caatacctac aagaacaacg ttggtgggtt gataggcact cccaaaaggg agacctggct acagctccga gctgagctgg aagctctcac agacctctgg ctgacccact ccctgaaggc actaaacctc atcaactccc ggcccaactg tgtcaatgtg ctggtcacca ccactcaact aattcctgcc ctggccaaag tcctgctata tggcctgggg tctgtgtttc ctattgagaa catctacagt gcaaccaaga cagggaagga gagctgcttc gagaggataa tgcagagatt cggcagaaaa gctgtctacg tggtgatcgg tgatggtgtg gaagaggagc aaggagcgaa aaagcacaac atgcctttct ggcggatatc ctgccacgca gacctggagg cactgaggca cgccctggag ctggagtatt tatag. It is sometimes possible for the material contained within the vial of "EYA2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.