Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EXT1 cdna clone

EXT1 cDNA Clone

Gene Names
EXT1; EXT; LGS; TTV; LGCR; TRPS2
Synonyms
EXT1; EXT1 cDNA Clone; EXT1 cdna clone
Ordering
For Research Use Only!
Sequence
atgcaggccaaaaaacgctatttcatcctgctctcagctggctcttgtctcgcccttttgttttatttcggaggcttgcagtttagggcatcgaggagccacagccggagagaagaacacagcggtaggaatggcttgcaccaccccagtccggatcatttctggccccgcttcccggacgctctgcgccccttcgttccttgggatcaattggaaaacgaggattccagcgtgcacatttccccccggcagaagcgagatgccaactccagcatctacaaaggcaagaagtgccgcatggagtcctgcttcgatttcaccctttgcaagaaaaacggcttcaaagtctacgtatacccacagcaaaaaggggagaaaatcgccgaaagttaccaaaacattctagcggccatcgagggctccaggttctacacctcggaccccagccaggcgtgcctctttgtcctgagtctggatactttagacagagaccagttgtcacctcagtatgtgcacaatttgagatccaaagtgcagagtctccacttgtggaacaatggtaggaatcatttaatttttaatttatattccggcacttggcctgactacaccgaggacgtggggtttgacatcggccaggcgatgctggccaaagccagcatcagtactgaaaacttccgacccaactttgatgtttctattcccctcttttctaaggatcatcccaggacaggaggggagagggggtttttgaagttcaacaccatccctcctctcaggaagtacatgctggtattcaaggggaagaggtacctgacagggataggatcagacaccaggaatgccttatatcacgtccataacggggaggacgttgtgctcctcaccacctgcaagcatggcaaagactggcaaaagcacaaggattctcgctgtgacagagacaacaccgagtatgagaagtatgattatcgggaaatgctgcacaatgccactttctgtctggttcctcgtggtcgcaggcttgggtccttcagattcctggaggctttgcaggctgcctgcgtccctgtgatgctcagcaatggatgggagttgccattctctgaagtgattaattggaaccaagctgccgtcataggcgatgagagattgttattacagattccttctacaatcaggtctattcatcaggataaaatcctagcacttagacagcagacacaattcttgtgggaggcttatttttcttcagttgagaagattgtattaactacactagagattattcaggacagaatattcaagcacatatcacgtaacagtttaatatggaacaaacatcctggaggattgttcgtactaccacagtattcatcttatctgggagattttccttactactatgctaatttaggtttaaagcccccctccaaattcactgcagtcatccatgcggtgacccccctggtctctcagtcccagccagtgttgaagcttctcgtggctgcagccaagtcccagtactgtgcccagatcatagttctatggaattgtgacaagcccctaccagccaaacaccgctggcctgccactgctgtgcctgtcgtcgtcattgaaggagagagcaaggttatgagcagccgttttctgccctacgacaacatcatcacagacgccgtgctcagccttgacgaggacacggtgctttcaacaacagaggtggatttcgccttcacagtgtggcagagcttccctgagaggattgtggggtaccccgcgcgcagccacttctgggataactctaaggagcggtggggatacacatcaaagtggacgaacgactactccatggtgttgacaggagctgctatttaccacaaatattatcactacctatactcccattacctgccagccagcctgaagaacatggtggaccaattggccaattgtgaggacattctcatgaacttcctggtgtctgctgtgacaaaattgcctccaatcaaagtgacccagaagaagcagtataaggagacaatgatgggacagacttctcgggcttcccgttgggctgaccctgaccactttgcccagcgacagagctgcatgaatacgtttgccagctggtttggctacatgccgctgatccactctcagatgaggctcgaccccgtcctctttaaagaccaggtctctattttgaggaagaaataccgagacattgagcgactttga
Sequence Length
2241
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
86,255 Da
NCBI Official Full Name
Homo sapiens exostoses (multiple) 1, mRNA
NCBI Official Synonym Full Names
exostosin glycosyltransferase 1
NCBI Official Symbol
EXT1
NCBI Official Synonym Symbols
EXT; LGS; TTV; LGCR; TRPS2
NCBI Protein Information
exostosin-1
UniProt Protein Name
Exostosin-1
Protein Family
UniProt Gene Name
EXT1
UniProt Entry Name
EXT1_HUMAN

NCBI Description

This gene encodes an endoplasmic reticulum-resident type II transmembrane glycosyltransferase involved in the chain elongation step of heparan sulfate biosynthesis. Mutations in this gene cause the type I form of multiple exostoses. [provided by RefSeq, Jul 2008]

Uniprot Description

EXT1: Glycosyltransferase required for the biosynthesis of heparan-sulfate. The EXT1/EXT2 complex possesses substantially higher glycosyltransferase activity than EXT1 or EXT2 alone. Appears to be a tumor suppressor. Defects in EXT1 are a cause of hereditary multiple exostoses type 1 (EXT1). EXT is a genetically heterogeneous bone disorder caused by genes segregating on human chromosomes 8, 11, and 19 and designated EXT1, EXT2 and EXT3 respectively. EXT is a dominantly inherited skeletal disorder primarily affecting endochondral bone during growth. The disease is characterized by formation of numerous cartilage-capped, benign bone tumors (osteocartilaginous exostoses or osteochondromas) that are often accompanied by skeletal deformities and short stature. In a small percentage of cases exostoses have exhibited malignant transformation resulting in an osteosarcoma or chondrosarcoma. Osteochondromas development can also occur as a sporadic event. Defects in EXT1 are a cause of tricho-rhino-phalangeal syndrome type 2 (TRPS2). A syndrome that combines the clinical features of trichorhinophalangeal syndrome type 1 and multiple exostoses type 1. Affected individuals manifest multiple dysmorphic facial features including large, laterally protruding ears, a bulbous nose, an elongated upper lip, as well as sparse scalp hair, winged scapulae, multiple cartilaginous exostoses, redundant skin, and mental retardation. A chromosomal aberration resulting in the loss of functional copies of TRPS1 and EXT1 has been found in TRPS2 patients. Defects in EXT1 are a cause of chondrosarcoma (CHDSA). It is a malignant neoplasm derived from cartilage cells. Chondrosarcomas range from slow-growing non-metastasizing lesions to highly aggressive metastasizing sarcomas. Belongs to the glycosyltransferase 47 family.

Protein type: EC 2.4.1.225; EC 2.4.1.224; Transferase; Membrane protein, integral; Motility/polarity/chemotaxis; Tumor suppressor; Glycan Metabolism - heparan sulfate biosynthesis

Chromosomal Location of Human Ortholog: 8q24.11

Cellular Component: endoplasmic reticulum; Golgi apparatus; Golgi membrane; integral to endoplasmic reticulum membrane; integral to membrane

Molecular Function: acetylglucosaminyltransferase activity; glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity; glucuronosyltransferase activity; N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity; protein heterodimerization activity; protein homodimerization activity; transferase activity, transferring glycosyl groups

Biological Process: cellular polysaccharide biosynthetic process; glycosaminoglycan biosynthetic process; heparan sulfate proteoglycan biosynthetic process; heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process; ossification; signal transduction; skeletal development

Disease: Chondrosarcoma; Exostoses, Multiple, Type I

Research Articles on EXT1

Similar Products

Product Notes

The EXT1 ext1 (Catalog #AAA1267455) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcaggcca aaaaacgcta tttcatcctg ctctcagctg gctcttgtct cgcccttttg ttttatttcg gaggcttgca gtttagggca tcgaggagcc acagccggag agaagaacac agcggtagga atggcttgca ccaccccagt ccggatcatt tctggccccg cttcccggac gctctgcgcc ccttcgttcc ttgggatcaa ttggaaaacg aggattccag cgtgcacatt tccccccggc agaagcgaga tgccaactcc agcatctaca aaggcaagaa gtgccgcatg gagtcctgct tcgatttcac cctttgcaag aaaaacggct tcaaagtcta cgtataccca cagcaaaaag gggagaaaat cgccgaaagt taccaaaaca ttctagcggc catcgagggc tccaggttct acacctcgga ccccagccag gcgtgcctct ttgtcctgag tctggatact ttagacagag accagttgtc acctcagtat gtgcacaatt tgagatccaa agtgcagagt ctccacttgt ggaacaatgg taggaatcat ttaattttta atttatattc cggcacttgg cctgactaca ccgaggacgt ggggtttgac atcggccagg cgatgctggc caaagccagc atcagtactg aaaacttccg acccaacttt gatgtttcta ttcccctctt ttctaaggat catcccagga caggagggga gagggggttt ttgaagttca acaccatccc tcctctcagg aagtacatgc tggtattcaa ggggaagagg tacctgacag ggataggatc agacaccagg aatgccttat atcacgtcca taacggggag gacgttgtgc tcctcaccac ctgcaagcat ggcaaagact ggcaaaagca caaggattct cgctgtgaca gagacaacac cgagtatgag aagtatgatt atcgggaaat gctgcacaat gccactttct gtctggttcc tcgtggtcgc aggcttgggt ccttcagatt cctggaggct ttgcaggctg cctgcgtccc tgtgatgctc agcaatggat gggagttgcc attctctgaa gtgattaatt ggaaccaagc tgccgtcata ggcgatgaga gattgttatt acagattcct tctacaatca ggtctattca tcaggataaa atcctagcac ttagacagca gacacaattc ttgtgggagg cttatttttc ttcagttgag aagattgtat taactacact agagattatt caggacagaa tattcaagca catatcacgt aacagtttaa tatggaacaa acatcctgga ggattgttcg tactaccaca gtattcatct tatctgggag attttcctta ctactatgct aatttaggtt taaagccccc ctccaaattc actgcagtca tccatgcggt gacccccctg gtctctcagt cccagccagt gttgaagctt ctcgtggctg cagccaagtc ccagtactgt gcccagatca tagttctatg gaattgtgac aagcccctac cagccaaaca ccgctggcct gccactgctg tgcctgtcgt cgtcattgaa ggagagagca aggttatgag cagccgtttt ctgccctacg acaacatcat cacagacgcc gtgctcagcc ttgacgagga cacggtgctt tcaacaacag aggtggattt cgccttcaca gtgtggcaga gcttccctga gaggattgtg gggtaccccg cgcgcagcca cttctgggat aactctaagg agcggtgggg atacacatca aagtggacga acgactactc catggtgttg acaggagctg ctatttacca caaatattat cactacctat actcccatta cctgccagcc agcctgaaga acatggtgga ccaattggcc aattgtgagg acattctcat gaacttcctg gtgtctgctg tgacaaaatt gcctccaatc aaagtgaccc agaagaagca gtataaggag acaatgatgg gacagacttc tcgggcttcc cgttgggctg accctgacca ctttgcccag cgacagagct gcatgaatac gtttgccagc tggtttggct acatgccgct gatccactct cagatgaggc tcgaccccgt cctctttaaa gaccaggtct ctattttgag gaagaaatac cgagacattg agcgactttg a. It is sometimes possible for the material contained within the vial of "EXT1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.