Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EXOC6 cdna clone

EXOC6 cDNA Clone

Gene Names
EXOC6; SEC15; EXOC6A; SEC15L; Sec15p; SEC15L1; SEC15L3
Synonyms
EXOC6; EXOC6 cDNA Clone; EXOC6 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggagaacagcgagagtctgggcaccgtccccgagcacgagcggatcttgcaggagatcgagagcaccgacaccgcctgtgtggggcccaccctccggtctgtgtatgatgaccaaccaaatgcgcacaagaagtttatggaaaagttagatgcttgtatccgtaatcatgacaaggaaattgaaaagatgtgtaattttcatcatcagggttttgtagatgctattacagaactccttaaagtaaggactgatgcagaaaaactgaaggtgcaagttactgataccaaccgaaggtttcaagatgctggaaaagaggtgatagtccacacagaagatatcattcgatgtagaattcagcagagaaatattacaactgtagtagaaaaattgcagttatgccttcctgtgctagaaatgtacagtaagctgaaagaacagatgagtgccaaaaggtactattctgccctaaaaactatggaacaattagagaatgtgtactttccctgggttagtcaataccggttttgtcagctcatgatagaaaatcttcccaaactccgtgaggatattaaagaaatctccatgtctgatctcaaagactttttggaaagtattcgaaaacattctgacaaaataggtgaaacagcaatgaaacaggcacagcatcagaaaaccttcagtgtttctctgcagaaacaaaataaaatgaaatttgggaaaaatatgtatataaatcgtgatagaattccagaggaaaggaatgaaactgtattgaaacattcacttgaagaagaggatgagaatgaagaagagatcttaactgttcaggatcttgttgatttttcccctgtttatcgatgtttgcacatttattctgttttgggtgacgaggaaacatttgaaaactattatcgaaaacaaagaaagaaacaagcaagactggtattgcaaccccagtcgaatatgcatgaaacagttgatggctatagaagatatttcactcaaattgtagggttctttgtggtagaagatcacattttacatgtgacccaaggattagtaaccagggcatacactgatgaactttggaacatggccctctcaaagataattgctgtccttagagctcattcatcctattgcactgatcctgatcttgttctggagctgaagaatcttattgtaatatttgcagatactttacagggttatggttttccagtgaaccgactttttgaccttttatttgaaataagagaccaatacaatgaaacactgcttaagaaatgggctggagttttcagggacatttttgaagaagataattacagccccatccctgttgtcaatgaagaagaatataaaattgtcatcagcaaatttccctttcaagatccagaccttgaaaagcagtctttcccaaagaaattccccatgtctcagtcagtgcctcatatttacattcaagttaaagaatttatttatgccagccttaaattttcagagtcactacaccggagctcaacagaaatagacgatatgcttagaaaatcaacaaatctgctgctgaccagaactttgagtagctgtttactgaaccttattagaaaacctcatataggtttgacagagctggtacaaatcatcataaacacaacacacctggagcaagcttgtaaatatcttgaggactttataactaacattacaaatatttcccaagaaactgttcatactacaagactttatggactttctactttcaaggatgctcgacatgcagcagaaggagaaatatataccaaactgaatcaaaaaattgatgaatttgttcagcttgctgattatgactggacaatgtctgagccagatggaagagctagtggttatttaatggaccttataaattttttgagaagcatctttcaagtgtttactcatttgcctgggaaagttgctcagacagcttgcatgtcagcctgccagcatctgtcaacatccttaatgcagatgctactggacagtgagttaaaacaaataagcatgggagctgttcagcagtttaacttagatgtcatacagtgtgaattgtttgccagctctgagcctgtgccaggattccagggggataccctgcagctagcattcattgacctcagacaactccttgacctgtttatggtttgggattggtctacttacctagctgattatgggcagccagcttctaagtaccttcgggtgaatccaaacacagcccttactcttttggagaagatgaaggatactagcaaaaagaacaatatatttgctcagttcgggaagaatgatcgagacaaacagaagttgatagagacagtcgtgaaacagctgagaagtttggtgaatggtatgtcccagcacatgtag
Sequence Length
2415
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
93,407 Da
NCBI Official Full Name
Homo sapiens exocyst complex component 6, mRNA
NCBI Official Synonym Full Names
exocyst complex component 6
NCBI Official Symbol
EXOC6
NCBI Official Synonym Symbols
SEC15; EXOC6A; SEC15L; Sec15p; SEC15L1; SEC15L3
NCBI Protein Information
exocyst complex component 6
UniProt Protein Name
Exocyst complex component 6
Protein Family
UniProt Gene Name
EXOC6
UniProt Synonym Gene Names
SEC15A; SEC15L; SEC15L1
UniProt Entry Name
EXOC6_HUMAN

NCBI Description

The protein encoded by this gene is highly similar to the Saccharomyces cerevisiae SEC15 gene product, which is essential for vesicular traffic from the Golgi apparatus to the cell surface in yeast. It is one of the components of a multiprotein complex required for exocytosis. The 5' portion of this gene and two neighboring cytochrome p450 genes are included in a deletion that results in an autosomal-dominant form of nonsyndromic optic nerve aplasia (ONA). Alternative splicing and the use of alternative promoters results in multiple transcript variants. A paralogous gene encoding a similar protein is present on chromosome 2. [provided by RefSeq, Jan 2016]

Uniprot Description

EXOC6: Component of the exocyst complex involved in the docking of exocytic vesicles with fusion sites on the plasma membrane. Together with RAB11A, RAB3IP, RAB8A, PARD3, PRKCI, ANXA2, CDC42 and DNMBP promotes transcytosis of PODXL to the apical membrane initiation sites (AMIS), apical surface formation and lumenogenesis. Belongs to the SEC15 family.

Chromosomal Location of Human Ortholog: 10q23.33

Cellular Component: cytosol; plasma membrane

Molecular Function: protein binding

Research Articles on EXOC6

Similar Products

Product Notes

The EXOC6 exoc6 (Catalog #AAA1274285) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggaga acagcgagag tctgggcacc gtccccgagc acgagcggat cttgcaggag atcgagagca ccgacaccgc ctgtgtgggg cccaccctcc ggtctgtgta tgatgaccaa ccaaatgcgc acaagaagtt tatggaaaag ttagatgctt gtatccgtaa tcatgacaag gaaattgaaa agatgtgtaa ttttcatcat cagggttttg tagatgctat tacagaactc cttaaagtaa ggactgatgc agaaaaactg aaggtgcaag ttactgatac caaccgaagg tttcaagatg ctggaaaaga ggtgatagtc cacacagaag atatcattcg atgtagaatt cagcagagaa atattacaac tgtagtagaa aaattgcagt tatgccttcc tgtgctagaa atgtacagta agctgaaaga acagatgagt gccaaaaggt actattctgc cctaaaaact atggaacaat tagagaatgt gtactttccc tgggttagtc aataccggtt ttgtcagctc atgatagaaa atcttcccaa actccgtgag gatattaaag aaatctccat gtctgatctc aaagactttt tggaaagtat tcgaaaacat tctgacaaaa taggtgaaac agcaatgaaa caggcacagc atcagaaaac cttcagtgtt tctctgcaga aacaaaataa aatgaaattt gggaaaaata tgtatataaa tcgtgataga attccagagg aaaggaatga aactgtattg aaacattcac ttgaagaaga ggatgagaat gaagaagaga tcttaactgt tcaggatctt gttgattttt cccctgttta tcgatgtttg cacatttatt ctgttttggg tgacgaggaa acatttgaaa actattatcg aaaacaaaga aagaaacaag caagactggt attgcaaccc cagtcgaata tgcatgaaac agttgatggc tatagaagat atttcactca aattgtaggg ttctttgtgg tagaagatca cattttacat gtgacccaag gattagtaac cagggcatac actgatgaac tttggaacat ggccctctca aagataattg ctgtccttag agctcattca tcctattgca ctgatcctga tcttgttctg gagctgaaga atcttattgt aatatttgca gatactttac agggttatgg ttttccagtg aaccgacttt ttgacctttt atttgaaata agagaccaat acaatgaaac actgcttaag aaatgggctg gagttttcag ggacattttt gaagaagata attacagccc catccctgtt gtcaatgaag aagaatataa aattgtcatc agcaaatttc cctttcaaga tccagacctt gaaaagcagt ctttcccaaa gaaattcccc atgtctcagt cagtgcctca tatttacatt caagttaaag aatttattta tgccagcctt aaattttcag agtcactaca ccggagctca acagaaatag acgatatgct tagaaaatca acaaatctgc tgctgaccag aactttgagt agctgtttac tgaaccttat tagaaaacct catataggtt tgacagagct ggtacaaatc atcataaaca caacacacct ggagcaagct tgtaaatatc ttgaggactt tataactaac attacaaata tttcccaaga aactgttcat actacaagac tttatggact ttctactttc aaggatgctc gacatgcagc agaaggagaa atatatacca aactgaatca aaaaattgat gaatttgttc agcttgctga ttatgactgg acaatgtctg agccagatgg aagagctagt ggttatttaa tggaccttat aaattttttg agaagcatct ttcaagtgtt tactcatttg cctgggaaag ttgctcagac agcttgcatg tcagcctgcc agcatctgtc aacatcctta atgcagatgc tactggacag tgagttaaaa caaataagca tgggagctgt tcagcagttt aacttagatg tcatacagtg tgaattgttt gccagctctg agcctgtgcc aggattccag ggggataccc tgcagctagc attcattgac ctcagacaac tccttgacct gtttatggtt tgggattggt ctacttacct agctgattat gggcagccag cttctaagta ccttcgggtg aatccaaaca cagcccttac tcttttggag aagatgaagg atactagcaa aaagaacaat atatttgctc agttcgggaa gaatgatcga gacaaacaga agttgataga gacagtcgtg aaacagctga gaagtttggt gaatggtatg tcccagcaca tgtag. It is sometimes possible for the material contained within the vial of "EXOC6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.