Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ETFDH cdna clone

ETFDH cDNA Clone

Gene Names
ETFDH; MADD; ETFQO
Synonyms
ETFDH; ETFDH cDNA Clone; ETFDH cdna clone
Ordering
For Research Use Only!
Sequence
atgctggtgccgctagccaagctgtcctgcctggcatatcagtgctttcatgccttaaaaattaagaaaaattatctacctctatgtgctataagatggtcttcaacttctactgtgcctcgaattactacccattatactatttatccccgggataaggacaagagatgggaaggagtgaacatggaaaggtttgcagaagaagcagatgttgtaatagttggtgcaggccctgcagggctctctgcagctgttcgtctaaaacagttggctgtggcacatgaaaaggacatccgtgtgtgtctagtggagaaagctgcccagataggagctcatactctctcaggggcttgccttgatccaggtgcttttaaagaactcttcccagactggaaagagaagggggctccacttaacactcctgtaacagaagacagatttggaattttaacagagaaatacagaattcctgtgccaattcttccagggcttccaatgaataatcatggcaattacattgtacgcttgggacatttagtgagctggatgggcgaacaagcagaagcccttggtgttgaagtataccctggttatgcagctgctgaggtcctttttcatgatgatggtagtgtaaaaggaattgccactaacgatgtagggatacaaaaggatggtgcaccaaaggcaacatttgagagaggactggaactacatgctaaagtcacaatttttgcagaaggttgccatggacatctagccaagcaactatataagaagtttgatttgagagcaaattgtgaacctcaaacctacgggattggactgaaggagttatgggttattgatgaaaagaactggaaacctgggagagtagatcacactgttggttggcccttggacagacatacctatggaggatctttcctctatcatttgaatgaaggtgaacccctagtagctcttggtcttgtggttggtctagactatcagaatccatacctgagtccatttagagagttccaaaggtggaaacaccatcctagcattcggccaaccttggaaggtggaaaaaggattgcatacggagccagagctctcaatgaaggtggctttcagtctataccaaaactcacctttcctggtggtttactaattggttgtagtcctggttttatgaatgttcccaagatcaaaggtactcacacagcaatgaaaagtggaattttagcagcagaatctatttttaatcaactaactagtgaaaatctccaatcaaagacaataggactccatgtaactgaatatgaggacaatttgaagaactcatgggtatggaaagagctatattctgttagaaatataagaccgtcctgccacggagtactgggtgtatatggagggatgatttacactggaatcttttactggatattgagaggaatggagccgtggactctgaaacataaaggttctgactttgaacggctcaagccagccaaggattgcacacctattgagtatccaaaacccgatggacagatcagttttgacctcttgtcatctgtggctctgagtggtactaatcatgaacatgaccagccggcacacttaaccttaagggatgacagtatacctgtaaatagaaatctgtcgatatatgatgggcccgagcagcgattctgtcctgcaggagtttatgaatttgtacctgtggaacaaggtgatggatttcggttacagataaatgctcagaactgtgtacattgtaaaacatgtgatattaaagatccaagtcagaatattaactgggtggtacctgaaggtggaggaggacctgcttacaatggaatgtaa
Sequence Length
1854
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
62,825 Da
NCBI Official Full Name
Homo sapiens electron-transferring-flavoprotein dehydrogenase, mRNA
NCBI Official Synonym Full Names
electron transfer flavoprotein dehydrogenase
NCBI Official Symbol
ETFDH
NCBI Official Synonym Symbols
MADD; ETFQO
NCBI Protein Information
electron transfer flavoprotein-ubiquinone oxidoreductase, mitochondrial
UniProt Protein Name
Electron transfer flavoprotein-ubiquinone oxidoreductase, mitochondrial
UniProt Gene Name
ETFDH
UniProt Synonym Gene Names
ETF-QO; ETF-ubiquinone oxidoreductase; ETF dehydrogenase
UniProt Entry Name
ETFD_HUMAN

NCBI Description

This gene encodes a component of the electron-transfer system in mitochondria and is essential for electron transfer from a number of mitochondrial flavin-containing dehydrogenases to the main respiratory chain. Mutations in this gene are associated with glutaric acidemia. Alternatively spliced transcript variants that encode distinct isoforms have been observed. [provided by RefSeq, Aug 2013]

Uniprot Description

ETFDH: Accepts electrons from ETF and reduces ubiquinone. Defects in ETFDH are the cause of glutaric aciduria type 2C (GA2C). GA2C is an autosomal recessively inherited disorder of fatty acid, amino acid, and choline metabolism. It is characterized by multiple acyl-CoA dehydrogenase deficiencies resulting in large excretion not only of glutaric acid, but also of lactic, ethylmalonic, butyric, isobutyric, 2-methyl-butyric, and isovaleric acids. Belongs to the ETF-QO/FixC family.

Protein type: Oxidoreductase; Mitochondrial; Membrane protein, integral; EC 1.5.5.1

Chromosomal Location of Human Ortholog: 4q32-q35

Cellular Component: integral to mitochondrial inner membrane; mitochondrial matrix; mitochondrial membrane

Molecular Function: 4 iron, 4 sulfur cluster binding; electron carrier activity; electron-transferring-flavoprotein dehydrogenase activity; FAD binding; oxidoreductase activity; oxidoreductase activity, oxidizing metal ions with flavin as acceptor; quinone binding; ubiquinone binding

Biological Process: fatty acid beta-oxidation using acyl-CoA dehydrogenase; response to oxidative stress

Disease: Multiple Acyl-coa Dehydrogenase Deficiency

Research Articles on ETFDH

Similar Products

Product Notes

The ETFDH etfdh (Catalog #AAA1269070) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctggtgc cgctagccaa gctgtcctgc ctggcatatc agtgctttca tgccttaaaa attaagaaaa attatctacc tctatgtgct ataagatggt cttcaacttc tactgtgcct cgaattacta cccattatac tatttatccc cgggataagg acaagagatg ggaaggagtg aacatggaaa ggtttgcaga agaagcagat gttgtaatag ttggtgcagg ccctgcaggg ctctctgcag ctgttcgtct aaaacagttg gctgtggcac atgaaaagga catccgtgtg tgtctagtgg agaaagctgc ccagatagga gctcatactc tctcaggggc ttgccttgat ccaggtgctt ttaaagaact cttcccagac tggaaagaga agggggctcc acttaacact cctgtaacag aagacagatt tggaatttta acagagaaat acagaattcc tgtgccaatt cttccagggc ttccaatgaa taatcatggc aattacattg tacgcttggg acatttagtg agctggatgg gcgaacaagc agaagccctt ggtgttgaag tataccctgg ttatgcagct gctgaggtcc tttttcatga tgatggtagt gtaaaaggaa ttgccactaa cgatgtaggg atacaaaagg atggtgcacc aaaggcaaca tttgagagag gactggaact acatgctaaa gtcacaattt ttgcagaagg ttgccatgga catctagcca agcaactata taagaagttt gatttgagag caaattgtga acctcaaacc tacgggattg gactgaagga gttatgggtt attgatgaaa agaactggaa acctgggaga gtagatcaca ctgttggttg gcccttggac agacatacct atggaggatc tttcctctat catttgaatg aaggtgaacc cctagtagct cttggtcttg tggttggtct agactatcag aatccatacc tgagtccatt tagagagttc caaaggtgga aacaccatcc tagcattcgg ccaaccttgg aaggtggaaa aaggattgca tacggagcca gagctctcaa tgaaggtggc tttcagtcta taccaaaact cacctttcct ggtggtttac taattggttg tagtcctggt tttatgaatg ttcccaagat caaaggtact cacacagcaa tgaaaagtgg aattttagca gcagaatcta tttttaatca actaactagt gaaaatctcc aatcaaagac aataggactc catgtaactg aatatgagga caatttgaag aactcatggg tatggaaaga gctatattct gttagaaata taagaccgtc ctgccacgga gtactgggtg tatatggagg gatgatttac actggaatct tttactggat attgagagga atggagccgt ggactctgaa acataaaggt tctgactttg aacggctcaa gccagccaag gattgcacac ctattgagta tccaaaaccc gatggacaga tcagttttga cctcttgtca tctgtggctc tgagtggtac taatcatgaa catgaccagc cggcacactt aaccttaagg gatgacagta tacctgtaaa tagaaatctg tcgatatatg atgggcccga gcagcgattc tgtcctgcag gagtttatga atttgtacct gtggaacaag gtgatggatt tcggttacag ataaatgctc agaactgtgt acattgtaaa acatgtgata ttaaagatcc aagtcagaat attaactggg tggtacctga aggtggagga ggacctgctt acaatggaat gtaa. It is sometimes possible for the material contained within the vial of "ETFDH, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.