Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ESRRG cdna clone

ESRRG cDNA Clone

Gene Names
ESRRG; ERR3; NR3B3; ERRgamma
Synonyms
ESRRG; ESRRG cDNA Clone; ESRRG cdna clone
Ordering
For Research Use Only!
Sequence
atgtcaaacaaagatcgacacattgattccagctgttcgtccttcatcaagacggaaccttccagcccagcctccctgacggacagcgtcaaccaccacagccctggtggctcttcagacgccagtgggagctacagttcaaccatgaatggccatcagaacggacttgactcgccacctctctacccttctgctcctatcctgggaggtagtgggcctgtcaggaaactgtatgatgactgctccagcaccattgttgaagatccccagaccaagtgtgaatacatgctcaactcgatgcccaagagactgtgtttagtgtgtggtgacatcgcttctgggtaccactatggggtagcatcatgtgaagcctgcaaggcattcttcaagaggacaattcaaggcaatatagaatacagctgccctgccacgaatgaatgtgaaatcacaaagcgcagacgtaaatcctgccaggcttgccgcttcatgaagtgtttaaaagtgggcatgctgaaagaaggggtgcgtcttgacagagtacgtggaggtcggcagaagtacaagcgcaggatagatgcggagaacagcccatacctgaaccctcagctggttcagccagccaaaaagccattgctctggtctgatcctgcagataacaagattgtctcacatttgttggtggctgaaccggagaagatctatgccatgcctgaccctactgtccccgacagtgacatcaaagccctcactacactgtgtgacttggccgaccgagagttggtggttatcattggatgggcgaagcatattccaggcttctccacgctgtccctggcggaccagatgagccttctgcagagtgcttggatggaaattttgatccttggtgtcgtataccggtctctttcgtttgaggatgaacttgtctatgcagacgattatataatggacgaagaccagtccaaattagcaggccttcttgatctaaataatgctatcctgcagctggtaaagaaatacaagagcatgaagctggaaaaagaagaatttgtcaccctcaaagctatagctcttgctaattcagactccatgcacatagaagatgttgaagccgttcagaagcttcaggatgtcttacatgaagcgctgcaggattatgaagctggccagcacatggaagaccctcgtcgagctggcaagatgctgatgacactgccactcctgaggcagacctctaccaaggccgtgcagcatttctacaacatcaaactagaaggcaaagtcccaatgcacaaactttttttggaaatgttggaggccaaggtctga
Sequence Length
1329
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
52,462 Da
NCBI Official Full Name
Homo sapiens estrogen-related receptor gamma, mRNA
NCBI Official Synonym Full Names
estrogen related receptor gamma
NCBI Official Symbol
ESRRG
NCBI Official Synonym Symbols
ERR3; NR3B3; ERRgamma
NCBI Protein Information
estrogen-related receptor gamma
UniProt Protein Name
Estrogen-related receptor gamma
Protein Family
UniProt Gene Name
ESRRG
UniProt Synonym Gene Names
ERR3; ERRG2; KIAA0832; NR3B3
UniProt Entry Name
ERR3_HUMAN

NCBI Description

This gene encodes a member of the estrogen receptor-related receptor (ESRR) family, which belongs to the nuclear hormone receptor superfamily. All members of the ESRR family share an almost identical DNA binding domain, which is composed of two C4-type zinc finger motifs. The ESRR members are orphan nuclear receptors; they bind to the estrogen response element and steroidogenic factor 1 response element, and activate genes controlled by both response elements in the absence of any ligands. The ESRR family is closely related to the estrogen receptor (ER) family. They share target genes, co-regulators and promoters, and by targeting the same set of genes, the ESRRs seem to interfere with the ER-mediated estrogen response in various ways. It has been reported that the family member encoded by this gene functions as a transcriptional activator of DNA cytosine-5-methyltransferases 1 (Dnmt1) expression by direct binding to its response elements in the DNMT1 promoters, modulates cell proliferation and estrogen signaling in breast cancer, and negatively regulates bone morphogenetic protein 2-induced osteoblast differentiation and bone formation. Multiple alternatively spliced transcript variants have been identified, which mainly differ at the 5' end and some of which encode protein isoforms differing in the N-terminal region. [provided by RefSeq, Aug 2011]

Uniprot Description

ERR3: Orphan receptor that acts as transcription activator in the absence of bound ligand. Binds specifically to an estrogen response element and activates reporter genes controlled by estrogen response elements. Belongs to the nuclear hormone receptor family. NR3 subfamily. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Transcription factor; Nuclear receptor; DNA-binding

Chromosomal Location of Human Ortholog: 1q41

Cellular Component: nucleoplasm

Molecular Function: AF-2 domain binding; protein binding

Biological Process: positive regulation of transcription, DNA-dependent; regulation of transcription, DNA-dependent; transcription initiation from RNA polymerase II promoter

Research Articles on ESRRG

Similar Products

Product Notes

The ESRRG esrrg (Catalog #AAA1266826) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcaaaca aagatcgaca cattgattcc agctgttcgt ccttcatcaa gacggaacct tccagcccag cctccctgac ggacagcgtc aaccaccaca gccctggtgg ctcttcagac gccagtggga gctacagttc aaccatgaat ggccatcaga acggacttga ctcgccacct ctctaccctt ctgctcctat cctgggaggt agtgggcctg tcaggaaact gtatgatgac tgctccagca ccattgttga agatccccag accaagtgtg aatacatgct caactcgatg cccaagagac tgtgtttagt gtgtggtgac atcgcttctg ggtaccacta tggggtagca tcatgtgaag cctgcaaggc attcttcaag aggacaattc aaggcaatat agaatacagc tgccctgcca cgaatgaatg tgaaatcaca aagcgcagac gtaaatcctg ccaggcttgc cgcttcatga agtgtttaaa agtgggcatg ctgaaagaag gggtgcgtct tgacagagta cgtggaggtc ggcagaagta caagcgcagg atagatgcgg agaacagccc atacctgaac cctcagctgg ttcagccagc caaaaagcca ttgctctggt ctgatcctgc agataacaag attgtctcac atttgttggt ggctgaaccg gagaagatct atgccatgcc tgaccctact gtccccgaca gtgacatcaa agccctcact acactgtgtg acttggccga ccgagagttg gtggttatca ttggatgggc gaagcatatt ccaggcttct ccacgctgtc cctggcggac cagatgagcc ttctgcagag tgcttggatg gaaattttga tccttggtgt cgtataccgg tctctttcgt ttgaggatga acttgtctat gcagacgatt atataatgga cgaagaccag tccaaattag caggccttct tgatctaaat aatgctatcc tgcagctggt aaagaaatac aagagcatga agctggaaaa agaagaattt gtcaccctca aagctatagc tcttgctaat tcagactcca tgcacataga agatgttgaa gccgttcaga agcttcagga tgtcttacat gaagcgctgc aggattatga agctggccag cacatggaag accctcgtcg agctggcaag atgctgatga cactgccact cctgaggcag acctctacca aggccgtgca gcatttctac aacatcaaac tagaaggcaa agtcccaatg cacaaacttt ttttggaaat gttggaggcc aaggtctga. It is sometimes possible for the material contained within the vial of "ESRRG, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.