Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ESR2 cdna clone

ESR2 cDNA Clone

Gene Names
ESR2; Erb; ESRB; ESTRB; NR3A2; ER-BETA; ESR-BETA
Synonyms
ESR2; ESR2 cDNA Clone; ESR2 cdna clone
Ordering
For Research Use Only!
Sequence
atggatataaaaaactcaccatctagccttaattctccttcctcctacaactgcagtcaatccatcttacccctggagcacggctccatatacataccttcctcctatgtagacagccaccatgaatatccagccatgacattctatagccctgctgtgatgaattacagcattcccagcaatgtcactaacttggaaggtgggcctggtcggcagaccacaagcccaaatgtgttgtggccaacacctgggcacctttctcctttagtggtccatcgccagttatcacatctgtatgcggaacctcaaaagagtccctggtgtgaagcaagatcgctagaacacaccttacctgtaaacagagagacactgaaaaggaaggttagtgggaaccgttgcgccagccctgttactggtccaggttcaaagagggatgctcacttctgcgctgtctgcagcgattacgcatcgggatatcactatggagtctggtcgtgtgaaggatgtaaggccttttttaaaagaagcattcaaggacataatgattatatttgtccagctacaaatcagtgtacaatcgataaaaaccggcgcaagagctgccaggcctgccgacttcggaagtgttacgaagtgggaatggtgaagtgtggctcccggagagagagatgtgggtaccgccttgtgcggagacagagaagtgccgacgagcagctgcactgtgccggcaaggccaagagaagtggcggccacgcgccccgagtgcgggagctgctgctggacgccctgagccccgagcagctagtgctcaccctcctggaggctgagccgccccatgtgctgatcagccgccccagtgcgcccttcaccgaggcctccatgatgatgtccctgaccaagttggccgacaaggagttggtacacatgatcagctgggccaagaagattcccgggatgaggggaaatgcgtag
Sequence Length
972
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
53,209 Da
NCBI Official Full Name
Homo sapiens estrogen receptor 2 (ER beta), mRNA
NCBI Official Synonym Full Names
estrogen receptor 2
NCBI Official Symbol
ESR2
NCBI Official Synonym Symbols
Erb; ESRB; ESTRB; NR3A2; ER-BETA; ESR-BETA
NCBI Protein Information
estrogen receptor beta
UniProt Protein Name
Estrogen receptor beta
Protein Family
UniProt Gene Name
ESR2
UniProt Synonym Gene Names
ESTRB; NR3A2; ER-beta
UniProt Entry Name
ESR2_HUMAN

NCBI Description

This gene encodes a member of the family of estrogen receptors and superfamily of nuclear receptor transcription factors. The gene product contains an N-terminal DNA binding domain and C-terminal ligand binding domain and is localized to the nucleus, cytoplasm, and mitochondria. Upon binding to 17beta-estradiol or related ligands, the encoded protein forms homo- or hetero-dimers that interact with specific DNA sequences to activate transcription. Some isoforms dominantly inhibit the activity of other estrogen receptor family members. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been fully characterized. [provided by RefSeq, Jul 2008]

Uniprot Description

ER-beta: a nuclear hormone receptor and transcription factor. Binds and activated by estrogen. Regulates gene expression and affects cellular proliferation and differentiation in target tissues. Binds estrogens with an affinity similar to that of ER-alpha, and activates expression of reporter genes containing estrogen response elements (ERE) in an estrogen-dependent manner. Eight alternatively-spliced isoforms have been described. Isoform beta-cx lacks ligand binding ability and has no or only very low ERE binding activity resulting in the loss of ligand-dependent transactivation ability.

Protein type: DNA-binding; Nuclear receptor

Chromosomal Location of Human Ortholog: 14q23.2

Cellular Component: mitochondrion; nucleoplasm; nucleus

Molecular Function: DNA binding; enzyme binding; estrogen receptor activity; estrogen response element binding; protein binding; steroid binding; steroid hormone receptor activity; transcription coactivator activity; transcription factor activity

Biological Process: cell-cell signaling; estrogen receptor signaling pathway; negative regulation of transcription from RNA polymerase II promoter; positive regulation of transcription factor activity; positive regulation of transcription, DNA-dependent; regulation of transcription, DNA-dependent; signal transduction; transcription initiation from RNA polymerase II promoter

Research Articles on ESR2

Similar Products

Product Notes

The ESR2 esr2 (Catalog #AAA1271149) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatataa aaaactcacc atctagcctt aattctcctt cctcctacaa ctgcagtcaa tccatcttac ccctggagca cggctccata tacatacctt cctcctatgt agacagccac catgaatatc cagccatgac attctatagc cctgctgtga tgaattacag cattcccagc aatgtcacta acttggaagg tgggcctggt cggcagacca caagcccaaa tgtgttgtgg ccaacacctg ggcacctttc tcctttagtg gtccatcgcc agttatcaca tctgtatgcg gaacctcaaa agagtccctg gtgtgaagca agatcgctag aacacacctt acctgtaaac agagagacac tgaaaaggaa ggttagtggg aaccgttgcg ccagccctgt tactggtcca ggttcaaaga gggatgctca cttctgcgct gtctgcagcg attacgcatc gggatatcac tatggagtct ggtcgtgtga aggatgtaag gcctttttta aaagaagcat tcaaggacat aatgattata tttgtccagc tacaaatcag tgtacaatcg ataaaaaccg gcgcaagagc tgccaggcct gccgacttcg gaagtgttac gaagtgggaa tggtgaagtg tggctcccgg agagagagat gtgggtaccg ccttgtgcgg agacagagaa gtgccgacga gcagctgcac tgtgccggca aggccaagag aagtggcggc cacgcgcccc gagtgcggga gctgctgctg gacgccctga gccccgagca gctagtgctc accctcctgg aggctgagcc gccccatgtg ctgatcagcc gccccagtgc gcccttcacc gaggcctcca tgatgatgtc cctgaccaag ttggccgaca aggagttggt acacatgatc agctgggcca agaagattcc cgggatgagg ggaaatgcgt ag. It is sometimes possible for the material contained within the vial of "ESR2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.