Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ERLIN2 cdna clone

ERLIN2 cDNA Clone

Gene Names
ERLIN2; NET32; SPFH2; SPG18; C8orf2; Erlin-2
Synonyms
ERLIN2; ERLIN2 cDNA Clone; ERLIN2 cdna clone
Ordering
For Research Use Only!
Sequence
atggctcagttgggagcagttgtggctgtggcttccagtttcttttgtgcatctctcttctcagctgtgcacaagatagaagagggacatattggggtatattacagaggcggtgccctgctgacttcgaccagcggccctggtttccatctcatgctccctttcatcacatcatataagtctgtgcagaccacactccagacagatgaggtgaagaatgtaccttgtgggactagtggtggtgtgatgatctactttgacagaattgaagtggtgaacttcctggtcccgaacgcagtgtatgatatagtgaagaactatactgctgactatgacaaggccctcatcttcaacaagatccaccacgaactgaaccagttctgcagtgtgcacacgcttcaagaggtctacattgagctgtttggtaagaaagtctctcctgagcatgccgtgcttaagcagggttcctggaaccccgcgtctctccactgcctaaagcctggctgcctgcagggtgtgatggtcacttatggacaggaaatgttaaagaatcttgtgctcaggagctggtcacaaaggagttcatggagaatgctgatagctatgcaacaagatccttag
Sequence Length
621
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,939 Da
NCBI Official Full Name
Homo sapiens ER lipid raft associated 2, mRNA
NCBI Official Synonym Full Names
ER lipid raft associated 2
NCBI Official Symbol
ERLIN2
NCBI Official Synonym Symbols
NET32; SPFH2; SPG18; C8orf2; Erlin-2
NCBI Protein Information
erlin-2
UniProt Protein Name
Erlin-2
Protein Family
UniProt Gene Name
ERLIN2
UniProt Synonym Gene Names
C8orf2; SPFH2; SPFH domain-containing protein 2
UniProt Entry Name
ERLN2_HUMAN

NCBI Description

This gene encodes a member of the SPFH domain-containing family of lipid raft-associated proteins. The encoded protein is localized to lipid rafts of the endoplasmic reticulum and plays a critical role in inositol 1,4,5-trisphosphate (IP3) signaling by mediating ER-associated degradation of activated IP3 receptors. Mutations in this gene are a cause of spastic paraplegia-18 (SPG18). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]

Uniprot Description

SPFH2: Component of the ERLIN1/ERLIN2 complex which mediates the endoplasmic reticulum-associated degradation (ERAD) of inositol 1,4,5-trisphosphate receptors (IP3Rs). Also involved in ITPR1 degradation by the ERAD pathway. Interacts with activated ITPR1, independently of the degree of ITPR1 polyubiquitination. Forms a heteromeric complex with ERLIN1. Ubiquitous. Belongs to the band 7/mec-2 family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Endoplasmic reticulum; Membrane protein, integral

Chromosomal Location of Human Ortholog: 8p11.2

Cellular Component: cytoplasm; endoplasmic reticulum; endoplasmic reticulum membrane; lipid raft; plasma membrane; protein complex

Molecular Function: cholesterol binding; protein binding; protein-tyrosine kinase activity; ubiquitin protein ligase binding

Biological Process: ER-associated protein catabolic process; negative regulation of cholesterol biosynthetic process; negative regulation of fatty acid biosynthetic process; SREBP-mediated signaling pathway

Disease: Spastic Paraplegia 18, Autosomal Recessive

Research Articles on ERLIN2

Similar Products

Product Notes

The ERLIN2 erlin2 (Catalog #AAA1278814) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctcagt tgggagcagt tgtggctgtg gcttccagtt tcttttgtgc atctctcttc tcagctgtgc acaagataga agagggacat attggggtat attacagagg cggtgccctg ctgacttcga ccagcggccc tggtttccat ctcatgctcc ctttcatcac atcatataag tctgtgcaga ccacactcca gacagatgag gtgaagaatg taccttgtgg gactagtggt ggtgtgatga tctactttga cagaattgaa gtggtgaact tcctggtccc gaacgcagtg tatgatatag tgaagaacta tactgctgac tatgacaagg ccctcatctt caacaagatc caccacgaac tgaaccagtt ctgcagtgtg cacacgcttc aagaggtcta cattgagctg tttggtaaga aagtctctcc tgagcatgcc gtgcttaagc agggttcctg gaaccccgcg tctctccact gcctaaagcc tggctgcctg cagggtgtga tggtcactta tggacaggaa atgttaaaga atcttgtgct caggagctgg tcacaaagga gttcatggag aatgctgata gctatgcaac aagatcctta g. It is sometimes possible for the material contained within the vial of "ERLIN2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.