Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ERGIC3 cdna clone

ERGIC3 cDNA Clone

Gene Names
ERGIC3; Erv46; CGI-54; PRO0989; C20orf47; NY-BR-84; SDBCAG84; dJ477O4.2
Synonyms
ERGIC3; ERGIC3 cDNA Clone; ERGIC3 cdna clone
Ordering
For Research Use Only!
Sequence
atggaggcgctggggaagctgaagcagttcgatgcctaccccaagactttggaggacttccgggtcaagacctgcgggggcgccaccgtgaccattgtcagtggccttctcatgctgctactgttcctgtccgagctgcagtattacctcaccacggaggtgcatcctgagctctacgtggacaagtcgcggggagataaactgaagatcaacatcgatgtactttttccgcacatgccttgtgcctatctgagtattgatgccatggatgtggccggagaacagcagctggatgtggaacacaacctgttcaagcaacgactagataaagatggcatccccgtgagctcagaggctgagcggcatgagcttgggaaagtcgaggtgacggtgtttgaccctgactccctggaccctgatcgctgtgagagctgctatggtgctgaggcagaagatatcaagtgctgtaacacctgtgaagatgtgcgggaggcatatcgccgtagaggctgggccttcaagaacccagatactattgagcagtgccggcgagagggcttcagccagaagatgcaggagcagaagaatgaaggctgccaggtgtatggcttcttggaagtcaataaggtggccggaaacttccactttgcccctgggaagagcttccagcagtcccatgtgcacgtccatgacttgcagagctttggccttgacaacatcaacatgacccactacatccagcacctgtcatttggggaggactatccaggcattgtgaaccccctggaccacaccaatgtcactgcgccccaagcctccatgatgttccagtactttgtgaaggtggtgcccactgtgtacatgaaggtggacggagaggtactgaggacaaatcagttctctgtgaccagacatgagaaggttgccaatgggctgttgggcgaccaaggccttcccggagtcttcgtcctctatgagctctcgcccatgatggtgaagctgacggagaagcacaggtccttcacccacttcctgacaggtgtgtgcgccatcattgggggcatgttcacagtggctggactcatcgattcgctcatctaccactcagcacgagccatccagaagaaaattgatctagggaagacaacgtag
Sequence Length
1152
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
43,772 Da
NCBI Official Full Name
Homo sapiens ERGIC and golgi 3, mRNA
NCBI Official Synonym Full Names
ERGIC and golgi 3
NCBI Official Symbol
ERGIC3
NCBI Official Synonym Symbols
Erv46; CGI-54; PRO0989; C20orf47; NY-BR-84; SDBCAG84; dJ477O4.2
NCBI Protein Information
endoplasmic reticulum-Golgi intermediate compartment protein 3
UniProt Protein Name
Endoplasmic reticulum-Golgi intermediate compartment protein 3
UniProt Gene Name
ERGIC3
UniProt Synonym Gene Names
C20orf47; ERV46; SDBCAG84
UniProt Entry Name
ERGI3_HUMAN

Uniprot Description

SDBCAG84: Possible role in transport between endoplasmic reticulum and Golgi. Belongs to the ERGIC family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Motility/polarity/chemotaxis; Membrane protein, integral; Membrane protein, multi-pass; Vesicle

Chromosomal Location of Human Ortholog: 20pter-q12

Cellular Component: membrane

Research Articles on ERGIC3

Similar Products

Product Notes

The ERGIC3 ergic3 (Catalog #AAA1274526) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggcgc tggggaagct gaagcagttc gatgcctacc ccaagacttt ggaggacttc cgggtcaaga cctgcggggg cgccaccgtg accattgtca gtggccttct catgctgcta ctgttcctgt ccgagctgca gtattacctc accacggagg tgcatcctga gctctacgtg gacaagtcgc ggggagataa actgaagatc aacatcgatg tactttttcc gcacatgcct tgtgcctatc tgagtattga tgccatggat gtggccggag aacagcagct ggatgtggaa cacaacctgt tcaagcaacg actagataaa gatggcatcc ccgtgagctc agaggctgag cggcatgagc ttgggaaagt cgaggtgacg gtgtttgacc ctgactccct ggaccctgat cgctgtgaga gctgctatgg tgctgaggca gaagatatca agtgctgtaa cacctgtgaa gatgtgcggg aggcatatcg ccgtagaggc tgggccttca agaacccaga tactattgag cagtgccggc gagagggctt cagccagaag atgcaggagc agaagaatga aggctgccag gtgtatggct tcttggaagt caataaggtg gccggaaact tccactttgc ccctgggaag agcttccagc agtcccatgt gcacgtccat gacttgcaga gctttggcct tgacaacatc aacatgaccc actacatcca gcacctgtca tttggggagg actatccagg cattgtgaac cccctggacc acaccaatgt cactgcgccc caagcctcca tgatgttcca gtactttgtg aaggtggtgc ccactgtgta catgaaggtg gacggagagg tactgaggac aaatcagttc tctgtgacca gacatgagaa ggttgccaat gggctgttgg gcgaccaagg ccttcccgga gtcttcgtcc tctatgagct ctcgcccatg atggtgaagc tgacggagaa gcacaggtcc ttcacccact tcctgacagg tgtgtgcgcc atcattgggg gcatgttcac agtggctgga ctcatcgatt cgctcatcta ccactcagca cgagccatcc agaagaaaat tgatctaggg aagacaacgt ag. It is sometimes possible for the material contained within the vial of "ERGIC3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.