Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ERBB4 cdna clone

ERBB4 cDNA Clone

Gene Names
ERBB4; HER4; ALS19; p180erbB4
Synonyms
ERBB4; ERBB4 cDNA Clone; ERBB4 cdna clone
Ordering
For Research Use Only!
Sequence
atgaagccggcgacaggactttgggtctgggtgagccttctcgtggcggcggggaccgtccagcccagcgattctcagtcagtgtgtgcaggaacggagaataaactgagctctctctctgacctggaacagcagtaccgagccttgcgcaagtactatgaaaactgtgaggttgtcatgggcaacctggagataaccagcattgagcacaaccgggacctctccttcctgcggtctgttcgagaagtcacaggctacgtgttagtggctcttaatcagtttcgttacctgcctctggagaatttacgcattattcgtgggacaaaactttatgaggatcgatatgccttggcaatatttttaaactacagaaaagatggaaactttggacttcaagaacttggattaaagaacttgacagaaatcctaaatggtggagtctatgtagaccagaacaaattcctttgttatgcagacaccattcattggcaagatattgttcggaacccatggccttccaacttgactcttgtgtcaacaaatggtagttcaggatgtggacgttgccataagtcctgtactggccgttgctggggacccacagaaaatcattgccagactttgacaaggacggtgtgtgcagaacaatgtgacggcagatgctacggaccttacgtcagtgactgctgccatcgagaatgtgctggaggctgctcaggacctaaggacacagactgctttgcctgcatgaatttcaatgacagtggagcatgtgttactcagtgtccccaaacctttgtctacaatccaaccacctttcaactggagcacaatttcaatgcaaagtacacatatggagcattctgtgtcaagaaatgtccacataactttgtggtagattccagttcttgtgtgcgtgcctgccctagttccaagatggaagtagaagaaaatgggattaaaatgtgtaaaccttgcactgacatttgcccaaaagcttgtgatggcattggcacaggatcattgatgtcagctcagactgtggattccagtaacattgacaaattcataaactgtaccaagatcaatgggaatttgatctttctagtcactggtattcatggggacccttacaatgcaattgaagccatagacccagagaaactgaacgtctttcggacagtcagagagataacaggtttcctgaacatacagtcatggccaccaaacatgactgacttcagtgttttttctaacctggtgaccattggtggaagagtactctatagtggcctgtccttgcttatcctcaagcaacagggcatcacctctctacagttccagtccctgaaggaaatcagcgcaggaaacatctatattactgacaacagcaacctgtgttattatcataccattaactggacaacactcttcagcacaatcaaccagagaatagtaatccgggacaacagaaaagctgaaaattgtactgctgaaggaatggtgtgcaaccatctgtgttccagtgatggctgttggggacctgggccagaccaatgtctgtcgtgtcgccgcttcagtagaggaaggatctgcatagagtcttgtaacctctatgatggtgaatttcgggagtttgagaatggctccatctgtgtggagtgtgacccccagtgtgagaagatggaagatggcctcctcacatgccatggaccgggtcctgacaactgtacaaagtgctctcattttaaagatggcccaaactgtgtggaaaaatgtccagatggcttacagggggcaaacagtttcattttcaagtatgctgatccagatcgggagtgccacccatgccatccaaactgcacccaagggtgtaacggtcccactagtcatgactgcatttactacccatggacgggccattccactttaccacaacatgctagaactcccctgattgcagctggagtaattggtgggctcttcattctggtcattgtgggtctgacatttgctgtttatgttagaaggaagagcatcaaaaagaaaagagccttgagaagattcttggaaacagagttggtggaaccattaactcccagtggcacagcacccaatcaagctcaacttcgtattttgaaagaaactgagctgaagagggtaaaagtccttggctcaggtgcttttggaacggtttataaaggtatttgggtacctgaaggagaaactgtgaagattcctgtggctattaagattcttaatgagacaactggtcccaaggcaaatgtggagttcatggatgaagctctgatcatggcaagtatggatcatccacacctagtccggttgctgggtgtgtgtctgagcccaaccatccagctggttactcaacttatgccccatggctgcctgttggagtatgtccacgagcacaaggataacattggatcacaactgctgcttaactggtgtgtccagatagctaagggaatgatgtacctggaagaaagacgactcgttcatcgggatttggcagcccgtaatgtcttagtgaaatctccaaaccatgtgaaaatcacagattttgggctagccagactcttggaaggagatgaaaaagagtacaatgctgatggaggaaagatgccaattaaatggatggctctggagtgtatacattacaggaaattcacccatcagagtgacgtttggagctatggagttactatatgggaactgatgacctttggaggaaaaccctatgatggaattccaacgcgagaaatccctgatttattagagaaaggagaacgtttgcctcagcctcccatctgcactattgacgtttacatggtcatggtcaaatgttggatgattgatgctgacagtagacctaaatttaaggaactggctgctgagttttcaaggatggctcgagaccctcaaagatacctagttattcagggtgatgatcgtatgaagcttcccagtccaaatgacagcaagttctttcagaatctcttggatgaagaggatttggaagatatgatggatgctgaggagtacttggtccctcaggctttcaacatcccacctcccatctatacttccagagcaagaattgactcgaataggagtgaaattggacacagccctcctcctgcctacacccccatgtcaggaaaccagtttgtataccgagatggaggttttgctgctgaacaaggagtgtctgtgccctacagagccccaactagcacaattccagaagctcctgtggcacagggtgctactgctgagatttttgatgactcctgctgtaatggcaccctacgcaagccagtggcaccccatgtccaagaggacagtagcacccagaggtacagtgctgaccccaccgtgtttgccccagaacggagcccacgaggagagctggatgaggaaggttacatgactcctatgcgagacaaacccaaacaagaatacctgaatccagtggaggagaacccttttgtttctcggagaaaaaatggagaccttcaagcattggataatcccgaatatcacaatgcatccaatggtccacccaaggccgaggatgagtatgtgaatgagccactgtacctcaacacctttgccaacaccttgggaaaagctgagtacctgaagaacaacatactgtcaatgccagagaaggccaagaaagcgtttgacaaccctgactactggaaccacagcctgccacctcggagcacccttcagcacccagactacctgcaggagtacagcacaaaatatttttataaacagaatgggcggatccggcctattgtggcagagaatcctgaatacctctctgagttctccctgaagccaggcactgtgctgccgcctccaccttacagacaccggaatactgtggtgtaa
Sequence Length
3927
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
143,968 Da
NCBI Official Full Name
Homo sapiens v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian), mRNA
NCBI Official Synonym Full Names
erb-b2 receptor tyrosine kinase 4
NCBI Official Symbol
ERBB4
NCBI Official Synonym Symbols
HER4; ALS19; p180erbB4
NCBI Protein Information
receptor tyrosine-protein kinase erbB-4
UniProt Protein Name
Receptor tyrosine-protein kinase erbB-4
UniProt Gene Name
ERBB4
UniProt Synonym Gene Names
HER4; 4ICD; E4ICD
UniProt Entry Name
ERBB4_HUMAN

NCBI Description

This gene is a member of the Tyr protein kinase family and the epidermal growth factor receptor subfamily. It encodes a single-pass type I membrane protein with multiple cysteine rich domains, a transmembrane domain, a tyrosine kinase domain, a phosphotidylinositol-3 kinase binding site and a PDZ domain binding motif. The protein binds to and is activated by neuregulins and other factors and induces a variety of cellular responses including mitogenesis and differentiation. Multiple proteolytic events allow for the release of a cytoplasmic fragment and an extracellular fragment. Mutations in this gene have been associated with cancer. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]

Uniprot Description

HER4: a receptor tyrosine kinase of the EGFR family. Specifically binds and is activated by neuregulins, NRG- 2, NRG-3, heparin-binding EGF-like growth factor, betacellulin and NTAK. Heterodimerizes and signals with other EGF receptors. Interaction with these factors induces cell differentiation. Not activated by EGF, TGF-A, and amphiregulin. Interacts with PDZ domains of DLG2, DLG3, DLG4 and the syntrophin SNTB2. Interacts with WWOX. May act as a tumor suppressor: overexpressed in head and neck cancer , but downregulated in renal cancer, papillary carcinoma, high-grade gliomas and invasive breast cancer. 3 alternatively-spliced isoforms of the human protein have been reported.

Protein type: Kinase, protein; Membrane protein, integral; EC 2.7.10.1; Protein kinase, tyrosine (receptor); Protein kinase, TK; TK group; EGFR family

Chromosomal Location of Human Ortholog: 2q33.3-q34

Cellular Component: basolateral plasma membrane; cytosol; extracellular region; mitochondrial matrix; mitochondrion; nucleoplasm; nucleus; plasma membrane; receptor complex

Molecular Function: epidermal growth factor receptor binding; phosphatidylinositol-4,5-bisphosphate 3-kinase activity; protein binding; protein homodimerization activity; protein-tyrosine kinase activity; Ras guanyl-nucleotide exchange factor activity; transmembrane receptor protein tyrosine kinase activity

Biological Process: cell migration; cell proliferation; central nervous system morphogenesis; embryonic pattern specification; heart development; lactation; MAPKKK cascade; mitochondrial fragmentation during apoptosis; negative regulation of cell proliferation; nervous system development; neural crest cell migration; olfactory bulb interneuron differentiation; peptidyl-tyrosine phosphorylation; phosphoinositide-mediated signaling; positive regulation of cardiac muscle cell proliferation; positive regulation of cell proliferation; positive regulation of protein amino acid phosphorylation; positive regulation of transcription, DNA-dependent; positive regulation of tyrosine phosphorylation of Stat5 protein; protein amino acid autophosphorylation; regulation of cell migration; regulation of phosphoinositide 3-kinase cascade; signal transduction; transmembrane receptor protein tyrosine kinase signaling pathway

Disease: Amyotrophic Lateral Sclerosis 19

Research Articles on ERBB4

Similar Products

Product Notes

The ERBB4 erbb4 (Catalog #AAA1277448) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagccgg cgacaggact ttgggtctgg gtgagccttc tcgtggcggc ggggaccgtc cagcccagcg attctcagtc agtgtgtgca ggaacggaga ataaactgag ctctctctct gacctggaac agcagtaccg agccttgcgc aagtactatg aaaactgtga ggttgtcatg ggcaacctgg agataaccag cattgagcac aaccgggacc tctccttcct gcggtctgtt cgagaagtca caggctacgt gttagtggct cttaatcagt ttcgttacct gcctctggag aatttacgca ttattcgtgg gacaaaactt tatgaggatc gatatgcctt ggcaatattt ttaaactaca gaaaagatgg aaactttgga cttcaagaac ttggattaaa gaacttgaca gaaatcctaa atggtggagt ctatgtagac cagaacaaat tcctttgtta tgcagacacc attcattggc aagatattgt tcggaaccca tggccttcca acttgactct tgtgtcaaca aatggtagtt caggatgtgg acgttgccat aagtcctgta ctggccgttg ctggggaccc acagaaaatc attgccagac tttgacaagg acggtgtgtg cagaacaatg tgacggcaga tgctacggac cttacgtcag tgactgctgc catcgagaat gtgctggagg ctgctcagga cctaaggaca cagactgctt tgcctgcatg aatttcaatg acagtggagc atgtgttact cagtgtcccc aaacctttgt ctacaatcca accacctttc aactggagca caatttcaat gcaaagtaca catatggagc attctgtgtc aagaaatgtc cacataactt tgtggtagat tccagttctt gtgtgcgtgc ctgccctagt tccaagatgg aagtagaaga aaatgggatt aaaatgtgta aaccttgcac tgacatttgc ccaaaagctt gtgatggcat tggcacagga tcattgatgt cagctcagac tgtggattcc agtaacattg acaaattcat aaactgtacc aagatcaatg ggaatttgat ctttctagtc actggtattc atggggaccc ttacaatgca attgaagcca tagacccaga gaaactgaac gtctttcgga cagtcagaga gataacaggt ttcctgaaca tacagtcatg gccaccaaac atgactgact tcagtgtttt ttctaacctg gtgaccattg gtggaagagt actctatagt ggcctgtcct tgcttatcct caagcaacag ggcatcacct ctctacagtt ccagtccctg aaggaaatca gcgcaggaaa catctatatt actgacaaca gcaacctgtg ttattatcat accattaact ggacaacact cttcagcaca atcaaccaga gaatagtaat ccgggacaac agaaaagctg aaaattgtac tgctgaagga atggtgtgca accatctgtg ttccagtgat ggctgttggg gacctgggcc agaccaatgt ctgtcgtgtc gccgcttcag tagaggaagg atctgcatag agtcttgtaa cctctatgat ggtgaatttc gggagtttga gaatggctcc atctgtgtgg agtgtgaccc ccagtgtgag aagatggaag atggcctcct cacatgccat ggaccgggtc ctgacaactg tacaaagtgc tctcatttta aagatggccc aaactgtgtg gaaaaatgtc cagatggctt acagggggca aacagtttca ttttcaagta tgctgatcca gatcgggagt gccacccatg ccatccaaac tgcacccaag ggtgtaacgg tcccactagt catgactgca tttactaccc atggacgggc cattccactt taccacaaca tgctagaact cccctgattg cagctggagt aattggtggg ctcttcattc tggtcattgt gggtctgaca tttgctgttt atgttagaag gaagagcatc aaaaagaaaa gagccttgag aagattcttg gaaacagagt tggtggaacc attaactccc agtggcacag cacccaatca agctcaactt cgtattttga aagaaactga gctgaagagg gtaaaagtcc ttggctcagg tgcttttgga acggtttata aaggtatttg ggtacctgaa ggagaaactg tgaagattcc tgtggctatt aagattctta atgagacaac tggtcccaag gcaaatgtgg agttcatgga tgaagctctg atcatggcaa gtatggatca tccacaccta gtccggttgc tgggtgtgtg tctgagccca accatccagc tggttactca acttatgccc catggctgcc tgttggagta tgtccacgag cacaaggata acattggatc acaactgctg cttaactggt gtgtccagat agctaaggga atgatgtacc tggaagaaag acgactcgtt catcgggatt tggcagcccg taatgtctta gtgaaatctc caaaccatgt gaaaatcaca gattttgggc tagccagact cttggaagga gatgaaaaag agtacaatgc tgatggagga aagatgccaa ttaaatggat ggctctggag tgtatacatt acaggaaatt cacccatcag agtgacgttt ggagctatgg agttactata tgggaactga tgacctttgg aggaaaaccc tatgatggaa ttccaacgcg agaaatccct gatttattag agaaaggaga acgtttgcct cagcctccca tctgcactat tgacgtttac atggtcatgg tcaaatgttg gatgattgat gctgacagta gacctaaatt taaggaactg gctgctgagt tttcaaggat ggctcgagac cctcaaagat acctagttat tcagggtgat gatcgtatga agcttcccag tccaaatgac agcaagttct ttcagaatct cttggatgaa gaggatttgg aagatatgat ggatgctgag gagtacttgg tccctcaggc tttcaacatc ccacctccca tctatacttc cagagcaaga attgactcga ataggagtga aattggacac agccctcctc ctgcctacac ccccatgtca ggaaaccagt ttgtataccg agatggaggt tttgctgctg aacaaggagt gtctgtgccc tacagagccc caactagcac aattccagaa gctcctgtgg cacagggtgc tactgctgag atttttgatg actcctgctg taatggcacc ctacgcaagc cagtggcacc ccatgtccaa gaggacagta gcacccagag gtacagtgct gaccccaccg tgtttgcccc agaacggagc ccacgaggag agctggatga ggaaggttac atgactccta tgcgagacaa acccaaacaa gaatacctga atccagtgga ggagaaccct tttgtttctc ggagaaaaaa tggagacctt caagcattgg ataatcccga atatcacaat gcatccaatg gtccacccaa ggccgaggat gagtatgtga atgagccact gtacctcaac acctttgcca acaccttggg aaaagctgag tacctgaaga acaacatact gtcaatgcca gagaaggcca agaaagcgtt tgacaaccct gactactgga accacagcct gccacctcgg agcacccttc agcacccaga ctacctgcag gagtacagca caaaatattt ttataaacag aatgggcgga tccggcctat tgtggcagag aatcctgaat acctctctga gttctccctg aagccaggca ctgtgctgcc gcctccacct tacagacacc ggaatactgt ggtgtaa. It is sometimes possible for the material contained within the vial of "ERBB4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.