Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EPHB2 cdna clone

EPHB2 cDNA Clone

Gene Names
EPHB2; DRT; EK5; ERK; CAPB; Hek5; PCBC; EPHT3; Tyro5
Synonyms
EPHB2; EPHB2 cDNA Clone; EPHB2 cdna clone
Ordering
For Research Use Only!
Sequence
atggctctgcggaggctgggggccgcgctgctgctgctgccgctgctcgccgccgtggaagaaacgctaatggactccactacagcgactgctgagctgggctggatggtgcatcctccatcagggtgggaagaggtgagtggctacgatgagaacatgaacacgatccgcacgtaccaggtgtgcaacgtgtttgagtcaagccagaacaactggctacggaccaagtttatccggcgccgtggcgcccaccgcatccacgtggagatgaagttttcggtgcgtgactgcagcagcatccccagcgtgcctggctcctgcaaggagaccttcaacctctattactatgaggctgactttgactcggccaccaagaccttccccaactggatggagaatccatgggtgaaggtggataccattgcagccgacgagagcttctcccaggtggacctgggtggccgcgtcatgaaaatcaacaccgaggtgcggagcttcggacctgtgtcccgcagcggcttctacctggccttccaggactatggcggctgcatgtccctcatcgccgtgcgtgtcttctaccgcaagtgcccccgcatcatccagaatggcgccatcttccaggaaaccctgtcgggggctgagagcacatcgctggtggctgcccggggcagctgcatcgccaatgcggaagaggtggatgtacccatcaagctctactgtaacggggacggcgagtggctggtgcccatcgggcgctgcatgtgcaaagcaggcttcgaggccgttgagaatggcaccgtctgccgaggttgtccatctgggactttcaaggccaaccaaggggatgaggcctgtacccactgtcccatcaacagccggaccacttctgaaggggccaccaactgtgtctgccgcaatggctactacagagcagacctggaccccctggacatgccctgcacaaccatcccctccgcgccccaggctgtgatttccagtgtcaatgagacctccctcatgctggagtggacccctccccgcgactccggaggccgagaggacctcgtctacaacatcatctgcaagagctgtggctcgggccggggtgcctgcacccgctgcggggacaatgtacagtacgcaccacgccagctaggcctgaccgagccacgcatttacatcagtgacctgctggcccacacccagtacaccttcgagatccaggctgtgaacggcgttactgaccagagccccttctcgcctcagttcgcctctgtgaacatcaccaccaaccaggcagctccatcggcagtgtccatcatgcatcaggtgagccgcaccgtggacagcattaccctgtcgtggtcccagccggaccagcccaatggcgtgatcctggactatgagctgcagtactatgagaagatgaagacacagagaagttaa
Sequence Length
1449
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
110,030 Da
NCBI Official Full Name
Homo sapiens EPH receptor B2, mRNA
NCBI Official Synonym Full Names
EPH receptor B2
NCBI Official Symbol
EPHB2
NCBI Official Synonym Symbols
DRT; EK5; ERK; CAPB; Hek5; PCBC; EPHT3; Tyro5
NCBI Protein Information
ephrin type-B receptor 2
UniProt Protein Name
Ephrin type-B receptor 2
Protein Family
UniProt Gene Name
EPHB2
UniProt Synonym Gene Names
DRT; EPHT3; EPTH3; ERK; HEK5; TYRO5; EK5; hEK5
UniProt Entry Name
EPHB2_HUMAN

NCBI Description

This gene encodes a member of the Eph receptor family of receptor tyrosine kinase transmembrane glycoproteins. These receptors are composed of an N-terminal glycosylated ligand-binding domain, a transmembrane region and an intracellular kinase domain. They bind ligands called ephrins and are involved in diverse cellular processes including motility, division, and differentiation. A distinguishing characteristic of Eph-ephrin signaling is that both receptors and ligands are competent to transduce a signaling cascade, resulting in bidirectional signaling. This protein belongs to a subgroup of the Eph receptors called EphB. Proteins of this subgroup are distinguished from other members of the family by sequence homology and preferential binding affinity for membrane-bound ephrin-B ligands. Allelic variants are associated with prostate and brain cancer susceptibility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2015]

Uniprot Description

EphB2: a receptor tyrosine kinase of the Eph family. A receptor for ephrin-B family members. Activated EphB2 recruits RasGAP, down-regulating the Ras-Erk signaling axis and neurite retraction. The Eph receptor tyrosine kinase family, the largest in the tyrosine kinase group, has fourteen members. They bind membrane-anchored ligands, ephrins, at sites of cell-cell contact, regulating the repulsion and adhesion of cells that underlie the establishment, maintenance, and remodeling of patterns of cellular organization. Eph signals are particularly important in regulating cell adhesion and cell migration during development, axon guidance, homeostasis and disease. EphA receptors bind to GPI-anchored ephrin-A ligands, while EphB receptors bind to ephrin-B proteins that have a transmembrane and cytoplasmic domain. Interactions between EphB receptor kinases and ephrin-B proteins transduce signals bidirectionally, signaling to both interacting cell types. Eph receptors and ephrins also regulate the adhesion of endothelial cells and are required for the remodeling of blood vessels. The ligand-activated form of EphB2 interacts with multiple proteins, including GTPase-activating protein (RASGAP) through its SH2 domain. Point mutations seen in prostate cancer. Overexpressed and required for migration of glioblastoma. Overexpressed and correlated with poor survival in breast cancer. Overexpression and loss of heterozygosity seen in colorectal cancers. Target for immunoconjugate drug therapy .Three splice-variant isoforms have been described.

Protein type: Tumor suppressor; EC 2.7.10.1; Kinase, protein; Protein kinase, TK; Protein kinase, tyrosine (receptor); Membrane protein, integral; TK group; Eph family

Chromosomal Location of Human Ortholog: 1p36.1-p35

Cellular Component: axon; cytosol; dendrite; extracellular region; integral to plasma membrane; plasma membrane

Molecular Function: protein binding; protein-tyrosine kinase activity; transmembrane-ephrin receptor activity

Biological Process: angiogenesis; axon guidance; axonal fasciculation; corpus callosum development; ephrin receptor signaling pathway; inner ear morphogenesis; nervous system development; palate development; peptidyl-tyrosine phosphorylation; phosphorylation; positive regulation of synaptogenesis; regulation of body fluid levels; urogenital system development

Disease: Prostate Cancer/brain Cancer Susceptibility

Research Articles on EPHB2

Similar Products

Product Notes

The EPHB2 ephb2 (Catalog #AAA1269717) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctctgc ggaggctggg ggccgcgctg ctgctgctgc cgctgctcgc cgccgtggaa gaaacgctaa tggactccac tacagcgact gctgagctgg gctggatggt gcatcctcca tcagggtggg aagaggtgag tggctacgat gagaacatga acacgatccg cacgtaccag gtgtgcaacg tgtttgagtc aagccagaac aactggctac ggaccaagtt tatccggcgc cgtggcgccc accgcatcca cgtggagatg aagttttcgg tgcgtgactg cagcagcatc cccagcgtgc ctggctcctg caaggagacc ttcaacctct attactatga ggctgacttt gactcggcca ccaagacctt ccccaactgg atggagaatc catgggtgaa ggtggatacc attgcagccg acgagagctt ctcccaggtg gacctgggtg gccgcgtcat gaaaatcaac accgaggtgc ggagcttcgg acctgtgtcc cgcagcggct tctacctggc cttccaggac tatggcggct gcatgtccct catcgccgtg cgtgtcttct accgcaagtg cccccgcatc atccagaatg gcgccatctt ccaggaaacc ctgtcggggg ctgagagcac atcgctggtg gctgcccggg gcagctgcat cgccaatgcg gaagaggtgg atgtacccat caagctctac tgtaacgggg acggcgagtg gctggtgccc atcgggcgct gcatgtgcaa agcaggcttc gaggccgttg agaatggcac cgtctgccga ggttgtccat ctgggacttt caaggccaac caaggggatg aggcctgtac ccactgtccc atcaacagcc ggaccacttc tgaaggggcc accaactgtg tctgccgcaa tggctactac agagcagacc tggaccccct ggacatgccc tgcacaacca tcccctccgc gccccaggct gtgatttcca gtgtcaatga gacctccctc atgctggagt ggacccctcc ccgcgactcc ggaggccgag aggacctcgt ctacaacatc atctgcaaga gctgtggctc gggccggggt gcctgcaccc gctgcgggga caatgtacag tacgcaccac gccagctagg cctgaccgag ccacgcattt acatcagtga cctgctggcc cacacccagt acaccttcga gatccaggct gtgaacggcg ttactgacca gagccccttc tcgcctcagt tcgcctctgt gaacatcacc accaaccagg cagctccatc ggcagtgtcc atcatgcatc aggtgagccg caccgtggac agcattaccc tgtcgtggtc ccagccggac cagcccaatg gcgtgatcct ggactatgag ctgcagtact atgagaagat gaagacacag agaagttaa. It is sometimes possible for the material contained within the vial of "EPHB2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.