Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EPHA10 cdna clone

EPHA10 cDNA Clone

Synonyms
EPHA10; EPHA10 cDNA Clone; EPHA10 cdna clone
Ordering
For Research Use Only!
Sequence
atggagacctgcgccggtccacacccgctgcgcctcttcctctgccggatgcagctctgtctcgcgctgcttttgggaccctggcggcctgggaccgccgaggaagttatcctcctggattccaaagcctcccaggccgagctgggctggactgcactgccaagtaatgggtgggaggagatcagcggcgtggatgaacacgaccgtcccatccgcacgtaccaagtgtgcaatgtgctggagcccaaccaggacaactggctgcagactggctggataagccgtggccgcgggcagcgcatcttcgtggaactgcagttcacactccgtgactgcagcagcatccctggcgccgcgggtacctgcaaggagaccttcaacgtctactacctggaaactgaggccgacctgggccgtgggcgtccccgcctaggcggcagccggccccgcaaaatcgacacgatcgcggcggacgagagcttcacgcagggcgacctgggtgagcgcaagatgaagctgaacacagaggtgcgcgagatcggaccgctcagccggcggggtttccacctggcctttcaggacgtgggcgcatgcgtggcgcttgtctcggtgcgcgtctactacaagcagtgccgcgccaccgtgcggggcctggccacgttcccagccaccgcagccgagagcgccttctccacactggtggaagtggccggaacgtgcgtggcgcactcggaaggggagcctggcagccccccacgcatgcactgcggcgccgacggcgagtggctggtgcctgtgggccgctgcagctgcagcgcgggattccaggagcgtggtgacttctgcgaaggtatccagttggctgggggccgtggggtgggagtgtag
Sequence Length
888
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
97,293 Da
NCBI Official Full Name
Homo sapiens EPH receptor A10, mRNA
NCBI Official Synonym Full Names
EPH receptor A10
NCBI Official Symbol
EPHA10
NCBI Protein Information
ephrin type-A receptor 10
UniProt Protein Name
Ephrin type-A receptor 10
Protein Family
UniProt Gene Name
EPHA10
UniProt Entry Name
EPHAA_HUMAN

NCBI Description

Ephrin receptors, the largest subfamily of receptor tyrosine kinases (RTKs), and their ephrin ligands are important mediators of cell-cell communication regulating cell attachment, shape, and mobility in neuronal and epithelial cells (Aasheim et al., 2005 [PubMed 15777695]). See MIM 179610 for additional background on Eph receptors and ephrins.[supplied by OMIM, Mar 2008]

Uniprot Description

EphA10: Receptor for members of the ephrin-A family. Binds to EFNA3, EFNA4 and EFNA5. Belongs to the protein kinase superfamily. Tyr protein kinase family. Ephrin receptor subfamily. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Kinase, protein; Protein kinase, tyrosine (receptor); Membrane protein, integral; EC 2.7.10.1; Protein kinase, TK; TK group; Eph family

Chromosomal Location of Human Ortholog: 1p34.3

Cellular Component: plasma membrane

Molecular Function: protein binding

Biological Process: ephrin receptor signaling pathway

Research Articles on EPHA10

Similar Products

Product Notes

The EPHA10 epha10 (Catalog #AAA1274112) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagacct gcgccggtcc acacccgctg cgcctcttcc tctgccggat gcagctctgt ctcgcgctgc ttttgggacc ctggcggcct gggaccgccg aggaagttat cctcctggat tccaaagcct cccaggccga gctgggctgg actgcactgc caagtaatgg gtgggaggag atcagcggcg tggatgaaca cgaccgtccc atccgcacgt accaagtgtg caatgtgctg gagcccaacc aggacaactg gctgcagact ggctggataa gccgtggccg cgggcagcgc atcttcgtgg aactgcagtt cacactccgt gactgcagca gcatccctgg cgccgcgggt acctgcaagg agaccttcaa cgtctactac ctggaaactg aggccgacct gggccgtggg cgtccccgcc taggcggcag ccggccccgc aaaatcgaca cgatcgcggc ggacgagagc ttcacgcagg gcgacctggg tgagcgcaag atgaagctga acacagaggt gcgcgagatc ggaccgctca gccggcgggg tttccacctg gcctttcagg acgtgggcgc atgcgtggcg cttgtctcgg tgcgcgtcta ctacaagcag tgccgcgcca ccgtgcgggg cctggccacg ttcccagcca ccgcagccga gagcgccttc tccacactgg tggaagtggc cggaacgtgc gtggcgcact cggaagggga gcctggcagc cccccacgca tgcactgcgg cgccgacggc gagtggctgg tgcctgtggg ccgctgcagc tgcagcgcgg gattccagga gcgtggtgac ttctgcgaag gtatccagtt ggctgggggc cgtggggtgg gagtgtag. It is sometimes possible for the material contained within the vial of "EPHA10, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.