Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ENPP6 cdna clone

ENPP6 cDNA Clone

Gene Names
ENPP6; NPP6
Synonyms
ENPP6; ENPP6 cDNA Clone; ENPP6 cdna clone
Ordering
For Research Use Only!
Sequence
atggcagtgaagcttgggaccctcctgctggcccttgccctgggcctggcccagccagcctctgcccgccggaagctgctggtgtttctgctggatggttttcgctcagactacatcagtgatgaggcgctggagtcattgcctggtttcaaagagattgtgagcaggggagtaaaagtggattacttgactccagacttccctagtctctcgtatcccaattattataccctaatgactggccgccattgtgaagtccatcagatgatcgggaactacatgtgggaccccaccaccaacaagtcctttgacattggcgtcaacaaagacagcctaatgcctctctggtggaatggatcagaacctctgtgggtcactctgaccaaggccaaaaggaaggtctacatgtactactggccaggctgtgaggttgagattctgggtgtcagacccacctactgcctagaatataaaaatgtcccaacggatatcaattttgccaatgcagtcagcgatgctcttgactccttcaagagtggccgggccgacctggcagccatataccatgagcgcattgacgtggaaggccaccactacgggcctgcatctccgcagaggaaagatgccctcaaggctgtagacactgtcctgaagtacatgaccaagtggatccaggagcggggcctgcaggaccgcctgaacgtcattattttctcggatcacggaatgaccgacattttctggatggacaaagtgattgagctgaataagtacatcagcctgaatgacctgcagcaagtgaaggaccgcgggcctgttgtgagcctttggccggcccctgggaaacactctgagatatataacaaactgagcacagtggaacacatgactgtctacgagaaagaagccatcccaagcaggttctattacaagaaaggaaagtttgtctctcctttgactttagtggctgatgaaggctggttcataactgagaatcgagagatgcttccgttttggatgaacagcaccggcaggcgggaaggttggcagcgtggatggcacggctacgacaacgagctcatggacatgcggggcatcttcctggccttcggacctgatttcaaatccaacttcagagctgctcctatcaggtcggtggacgtctacaatgtcatgtgcaatgtggtgggcatcaccccgctgcccaacaacggatcctggtccagggtgatgtgcatgctgaagggccgcgccagcactgccccgcctgtctggcccagccactgtgccctggcactgattcttctcttcctgcttgcataa
Sequence Length
1323
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
50,241 Da
NCBI Official Full Name
Homo sapiens ectonucleotide pyrophosphatase/phosphodiesterase 6, mRNA
NCBI Official Synonym Full Names
ectonucleotide pyrophosphatase/phosphodiesterase 6
NCBI Official Symbol
ENPP6
NCBI Official Synonym Symbols
NPP6
NCBI Protein Information
ectonucleotide pyrophosphatase/phosphodiesterase family member 6
UniProt Protein Name
Ectonucleotide pyrophosphatase/phosphodiesterase family member 6
UniProt Gene Name
ENPP6
UniProt Synonym Gene Names
E-NPP 6; NPP-6; GPC-Cpde
UniProt Entry Name
ENPP6_HUMAN

Uniprot Description

ENPP6: Choline-specific glycerophosphodiester phosphodiesterase. Hydrolyzes lysophosphatidylcholine (LPC) to form monoacylglycerol and phosphorylcholine but not lysophosphatidic acid, showing it has a lysophospholipase C activity. Has a preference for LPC with short (12:0 and 14:0) or polyunsaturated (18:2 and 20:4) fatty acids. Also hydrolyzes glycerophosphorylcholine and sphingosylphosphorylcholine efficiently. Hydrolyzes the classical substrate for phospholipase C, p-nitrophenyl phosphorylcholine in vitro, while it does not hydrolyze the classical nucleotide phosphodiesterase substrate, p- nitrophenyl thymidine 5'-monophosphate. Does not hydrolyze diacyl phospholipids such as phosphatidylethanolamine, phosphatidylinositol, phosphatidylserine, phosphatidylglycerol and phosphatidic acid. Belongs to the nucleotide pyrophosphatase/phosphodiesterase family.

Protein type: Membrane protein, GPI anchor; Phosphodiesterase; Lipid Metabolism - ether lipid; EC 3.1.4.38; Membrane protein, integral; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 4q35.1

Cellular Component: extracellular region; plasma membrane

Molecular Function: glycerophosphocholine cholinephosphodiesterase activity; phosphoric diester hydrolase activity

Biological Process: choline metabolic process; glycerophospholipid catabolic process; lipid metabolic process

Research Articles on ENPP6

Similar Products

Product Notes

The ENPP6 enpp6 (Catalog #AAA1275366) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagtga agcttgggac cctcctgctg gcccttgccc tgggcctggc ccagccagcc tctgcccgcc ggaagctgct ggtgtttctg ctggatggtt ttcgctcaga ctacatcagt gatgaggcgc tggagtcatt gcctggtttc aaagagattg tgagcagggg agtaaaagtg gattacttga ctccagactt ccctagtctc tcgtatccca attattatac cctaatgact ggccgccatt gtgaagtcca tcagatgatc gggaactaca tgtgggaccc caccaccaac aagtcctttg acattggcgt caacaaagac agcctaatgc ctctctggtg gaatggatca gaacctctgt gggtcactct gaccaaggcc aaaaggaagg tctacatgta ctactggcca ggctgtgagg ttgagattct gggtgtcaga cccacctact gcctagaata taaaaatgtc ccaacggata tcaattttgc caatgcagtc agcgatgctc ttgactcctt caagagtggc cgggccgacc tggcagccat ataccatgag cgcattgacg tggaaggcca ccactacggg cctgcatctc cgcagaggaa agatgccctc aaggctgtag acactgtcct gaagtacatg accaagtgga tccaggagcg gggcctgcag gaccgcctga acgtcattat tttctcggat cacggaatga ccgacatttt ctggatggac aaagtgattg agctgaataa gtacatcagc ctgaatgacc tgcagcaagt gaaggaccgc gggcctgttg tgagcctttg gccggcccct gggaaacact ctgagatata taacaaactg agcacagtgg aacacatgac tgtctacgag aaagaagcca tcccaagcag gttctattac aagaaaggaa agtttgtctc tcctttgact ttagtggctg atgaaggctg gttcataact gagaatcgag agatgcttcc gttttggatg aacagcaccg gcaggcggga aggttggcag cgtggatggc acggctacga caacgagctc atggacatgc ggggcatctt cctggccttc ggacctgatt tcaaatccaa cttcagagct gctcctatca ggtcggtgga cgtctacaat gtcatgtgca atgtggtggg catcaccccg ctgcccaaca acggatcctg gtccagggtg atgtgcatgc tgaagggccg cgccagcact gccccgcctg tctggcccag ccactgtgcc ctggcactga ttcttctctt cctgcttgca taa. It is sometimes possible for the material contained within the vial of "ENPP6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.