Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ENAH cdna clone

ENAH cDNA Clone

Gene Names
ENAH; ENA; MENA; NDPP1
Synonyms
ENAH; ENAH cDNA Clone; ENAH cdna clone
Ordering
For Research Use Only!
Sequence
atggaaattcaaagaagacaactacaagaacagcaacggcaaaaggagctggagcgggaaaggctggagcgagaaagaatggaaagagaaaggttggagagagagaggttagaaagggaaaggctggagagggagcgactggaacaagaacagctggagagagagagacaagaacgggaacggcaggaacgcctggagcggcaggaacgcctggagcggcaggaacgcctggatcgggagaggcaagaaagacaagaacgagagaggctggagagactggaacgggagaggcaagaaagggagcgacaagagcagttagaaagggaacagctggaatgggagagagagcgcagaatatcaagtgctggtaagaagtttacaaactcttctgtgttcttgtatctgagcttggatgatgtctcttgtgcagtcatgtgttaa
Sequence Length
441
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
60,349 Da
NCBI Official Full Name
Homo sapiens cDNA clone IMAGE:3946506, containing frame-shift errors
NCBI Official Synonym Full Names
enabled homolog (Drosophila)
NCBI Official Symbol
ENAH
NCBI Official Synonym Symbols
ENA; MENA; NDPP1
NCBI Protein Information
protein enabled homolog
UniProt Protein Name
Protein enabled homolog
Protein Family
UniProt Gene Name
ENAH
UniProt Synonym Gene Names
MENA
UniProt Entry Name
ENAH_HUMAN

Uniprot Description

Mena: Ena/VASP proteins are actin-associated proteins involved in a range of processes dependent on cytoskeleton remodeling and cell polarity such as axon guidance and lamellipodial and filopodial dynamics in migrating cells. ENAH induces the formation of F-actin rich outgrowths in fibroblasts. Acts synergistically with BAIAP2-alpha and downstream of NTN1 to promote filipodia formation. Required for the actin-based mobility of Listeria monocytogenes. Homotetramer. Interacts with APBB1IP, APBB1, PFN1 and ROBO4. Isoforms, containing the polyproline-rich regions with PPLP motifs, bind the WW domain of APBB1IP. Isoforms, containing the PPSY motif, bind, in vitro, to the WW2 and WW3 domains of NEDD4 and to the WW1 domain of YAP1. Binds the SH3 domain of BAIAP2-alpha but only after the autoinhibitory region of BAIAP2-alpha has been blocked by interaction with CDC42. Interacts, via the EVH1/WH1 domain, with the Pro-rich domains from VCL, ZYX and Listeria monocytogenes actA and with TES (via LIM domains). The TES LIM domain and the Pro-rich domains from VCL or ZYX compete for the same binding site. Interaction with ZYX is important for targeting ENAH to focal adhesions and enhances production of actin-rich structures at the apical surface of cells. Interacts, through the Pro-rich region, with the C-terminal SH3 domain of DNMPB. Binds GPHN. Interacts with FAT1 (via EVH1 domains). Heterotrimer with TES and ACTL7A. Expressed in myoepithelia of parotid, breast, bronchial glands and sweat glands. Expressed in colon-rectum muscolaris mucosae epithelium, pancreas acinar ductal epithelium, endometrium epithelium, prostate fibromuscolar stroma and placenta vascular media. Overexpressed in a majority of breast cancer cell lines and primary breast tumor lesions. Belongs to the Ena/VASP family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Adaptor/scaffold; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 1q42.12

Cellular Component: cell junction; cytoplasm; cytosol; focal adhesion; plasma membrane

Molecular Function: protein binding; WW domain binding

Biological Process: axon guidance

Research Articles on ENAH

Similar Products

Product Notes

The ENAH enah (Catalog #AAA1271456) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaaattc aaagaagaca actacaagaa cagcaacggc aaaaggagct ggagcgggaa aggctggagc gagaaagaat ggaaagagaa aggttggaga gagagaggtt agaaagggaa aggctggaga gggagcgact ggaacaagaa cagctggaga gagagagaca agaacgggaa cggcaggaac gcctggagcg gcaggaacgc ctggagcggc aggaacgcct ggatcgggag aggcaagaaa gacaagaacg agagaggctg gagagactgg aacgggagag gcaagaaagg gagcgacaag agcagttaga aagggaacag ctggaatggg agagagagcg cagaatatca agtgctggta agaagtttac aaactcttct gtgttcttgt atctgagctt ggatgatgtc tcttgtgcag tcatgtgtta a. It is sometimes possible for the material contained within the vial of "ENAH, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.