Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EMG1 cdna clone

EMG1 cDNA Clone

Gene Names
EMG1; C2F; NEP1; Grcc2f
Synonyms
EMG1; EMG1 cDNA Clone; EMG1 cdna clone
Ordering
For Research Use Only!
Sequence
atggccgcgcccagtgatggattcaagcctcgtgaacgaagcggtggggagcaggcacaggactgggatgctctgccacccaagcggccccgactaggggcaggaaacaagatcggaggccgtaggcttattgtggtgctggaaggggccagtctggagacagtcaaggtagggaagacatatgagctactcaactgtgacaagcacaagtctatattgttgaagaatggacgggaccctggggaagcgcggccagatatcacccaccagagtttgctgatgctgatggatagtcccctgaaccgagctggcttgctacaggtttatatccatacacagaagaatgttctgattgaagtgaatccccagacccgaattcccagaacctttgaccgcttttgtggcctcatggttcaacttttacacaagctcagtgttcgagcagctgatggcccccagaagcttttgaaggtaattaagaatccagtatcagatcactttccagttggatgtatgaaagttggcacttctttttccatcccggttgtcagtgatgtgcgtgagctggtgcccagcagtgatcctattgtttttgtggtaggggcctttgcccatggcaaggtcagtgtggagtatacagagaagatggtgtccatcagtaactaccccctttctgctgccctcacctgtgcaaaacttaccacagcctttgaggaagtatggggggtcatttga
Sequence Length
735
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
26,720 Da
NCBI Official Full Name
Homo sapiens EMG1 nucleolar protein homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
EMG1, N1-specific pseudouridine methyltransferase
NCBI Official Symbol
EMG1
NCBI Official Synonym Symbols
C2F; NEP1; Grcc2f
NCBI Protein Information
ribosomal RNA small subunit methyltransferase NEP1
UniProt Protein Name
Ribosomal RNA small subunit methyltransferase NEP1
UniProt Gene Name
EMG1
UniProt Entry Name
NEP1_HUMAN

NCBI Description

This gene encodes an essential, conserved eukaryotic protein that methylates pseudouridine in 18S rRNA. The related protein in yeast is a component of the small subunit processome and is essential for biogenesis of the ribosomal 40S subunit. A mutation in this gene has been associated with Bowen-Conradi syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]

Uniprot Description

C2F: Involved in 40S ribosomal subunit biogenesis and 18S rRNA processing. Specifically catalyzes the N1-methylation of pseudouridine at position 1248 (Psi1248) in 18S rRNA. Thus, appears to be the methyltransferase involved in the biosynthesis of the hypermodified N1-methyl-N3-(3-amino-3-carboxypropyl) pseudouridine (m1acp3-Psi) in position 1248 in 18S rRNA. Is not able to methylate uridine at this position. Defects in EMG1 are the cause of Bowen-Conradi syndrome (BWCNS). BWCNS is a combination of malformations characterized in newborns by low birth weight, microcephaly, mild joint restriction, a prominent nose, micrognathia, fifth finger clinodactyly, and 'rocker-bottom' feet. The syndrome is transmitted as an autosomal recessive trait. The prognosis is poor, with all infants dying within the first few months of life. Belongs to the NEP1 family.

Protein type: EC 2.1.1.-; Nucleolus; RNA-binding

Chromosomal Location of Human Ortholog: 12p13.3

Cellular Component: cytoplasm; nucleolus; nucleoplasm; nucleus; small subunit processome

Molecular Function: protein binding; RNA binding; rRNA binding

Biological Process: maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA); ribosomal small subunit biogenesis and assembly; rRNA processing

Disease: Bowen-conradi Syndrome

Research Articles on EMG1

Similar Products

Product Notes

The EMG1 emg1 (Catalog #AAA1274081) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccgcgc ccagtgatgg attcaagcct cgtgaacgaa gcggtgggga gcaggcacag gactgggatg ctctgccacc caagcggccc cgactagggg caggaaacaa gatcggaggc cgtaggctta ttgtggtgct ggaaggggcc agtctggaga cagtcaaggt agggaagaca tatgagctac tcaactgtga caagcacaag tctatattgt tgaagaatgg acgggaccct ggggaagcgc ggccagatat cacccaccag agtttgctga tgctgatgga tagtcccctg aaccgagctg gcttgctaca ggtttatatc catacacaga agaatgttct gattgaagtg aatccccaga cccgaattcc cagaaccttt gaccgctttt gtggcctcat ggttcaactt ttacacaagc tcagtgttcg agcagctgat ggcccccaga agcttttgaa ggtaattaag aatccagtat cagatcactt tccagttgga tgtatgaaag ttggcacttc tttttccatc ccggttgtca gtgatgtgcg tgagctggtg cccagcagtg atcctattgt ttttgtggta ggggcctttg cccatggcaa ggtcagtgtg gagtatacag agaagatggt gtccatcagt aactaccccc tttctgctgc cctcacctgt gcaaaactta ccacagcctt tgaggaagta tggggggtca tttga. It is sometimes possible for the material contained within the vial of "EMG1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.