Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EMCN cdna clone

EMCN cDNA Clone

Gene Names
EMCN; EMCN2; MUC14
Synonyms
EMCN; EMCN cDNA Clone; EMCN cdna clone
Ordering
For Research Use Only!
Sequence
atggaactgcttcaagtgaccattctttttcttctgcccagtatttgcagcagtaacagcacaggtgttttagaggcagctaataattcacttgttgttactacaacaaaaccatctataacaacaccaaacacagaatcattacagaaaaatgttgtcacaccaacaactggaacaactcctaaaggaacaatcaccaatgaattacttaaaatgtctctgatgtcaacagctacttttttaacaagtaaagatgaaggattgaaagccacaaccactgatgtcaggaagaatgactccatcatttcaaacgtaacagtaacaagtgttacacttccaaatgctgtttcaacattacaaagttccaaacccaagactgaaactcagagttcaattaaaacaacagaaataccaggcacaccagaaaatggaaatgatcaacctcagtctgataaagagagcgtgaagcttcttaccgttaagacaatttctcatgagtctggtgagcactctgcacaaggaaaaaccaagaactga
Sequence Length
537
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
26,066 Da
NCBI Official Full Name
Homo sapiens endomucin, mRNA
NCBI Official Synonym Full Names
endomucin
NCBI Official Symbol
EMCN
NCBI Official Synonym Symbols
EMCN2; MUC14
NCBI Protein Information
endomucin
UniProt Protein Name
Endomucin
Protein Family
UniProt Gene Name
EMCN
UniProt Synonym Gene Names
EMCN2; MUC14; MUC-14
UniProt Entry Name
MUCEN_HUMAN

NCBI Description

EMCN is a mucin-like sialoglycoprotein that interferes with the assembly of focal adhesion complexes and inhibits interaction between cells and the extracellular matrix (Kinoshita et al., 2001 [PubMed 11418125]).[supplied by OMIM, Mar 2008]

Uniprot Description

EMCN: Endothelial sialomucin, also called endomucin or mucin- like sialoglycoprotein, which interferes with the assembly of focal adhesion complexes and inhibits interaction between cells and the extracellular matrix. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Cell adhesion; Membrane protein, integral

Chromosomal Location of Human Ortholog: 4q24

Research Articles on EMCN

Similar Products

Product Notes

The EMCN emcn (Catalog #AAA1275386) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaactgc ttcaagtgac cattcttttt cttctgccca gtatttgcag cagtaacagc acaggtgttt tagaggcagc taataattca cttgttgtta ctacaacaaa accatctata acaacaccaa acacagaatc attacagaaa aatgttgtca caccaacaac tggaacaact cctaaaggaa caatcaccaa tgaattactt aaaatgtctc tgatgtcaac agctactttt ttaacaagta aagatgaagg attgaaagcc acaaccactg atgtcaggaa gaatgactcc atcatttcaa acgtaacagt aacaagtgtt acacttccaa atgctgtttc aacattacaa agttccaaac ccaagactga aactcagagt tcaattaaaa caacagaaat accaggcaca ccagaaaatg gaaatgatca acctcagtct gataaagaga gcgtgaagct tcttaccgtt aagacaattt ctcatgagtc tggtgagcac tctgcacaag gaaaaaccaa gaactga. It is sometimes possible for the material contained within the vial of "EMCN, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.