ELOVL2 cdna clone
ELOVL2 cDNA Clone
Gene Names
ELOVL2; SSC2
Synonyms
ELOVL2; ELOVL2 cDNA Clone; ELOVL2 cdna clone
Sequence
atggaacatctaaaggcctttgatgatgaaatcaatgcttttttggacaatatgtttggaccgcgagattctcgagtcagagggtggttcatgttggactcttaccttcctaccttttttcttactgtcatgtatctgctctcaatatggctgggtaacaagtatatgaagaacagacctgctctttctctcaggggtatcctcaccttgtataatcttggaatcacacttctatccgcgtacatgctggcagagctcattctctccacttgggaaggaggctacaacttacagtgtcaagatcttaccagcgcaggggaagctgacatccgggtagccaaggtgctttggtggtactatttctccaaatcagtagagttcctggacacaattttcttcgttttgcggaaaaaaacgagtcagattacttttcttcatgtatatcatcatgcttctatgtttaacatctggtggtgtgtcttgaactggataccttgtggacaaagtttctttggaccaacactgaacagttttatccacattcttatgtactcctactatggactttctgtgtttccatctatgcacaagtatctttggtggaagaaatatctcacacaggctcagctggtgcagttcgtgctcgccatcacgcacaccatgagcgccgtcgtgaaaccgtgtggcttccccttcggttgtctcatcttccagtcatcttatatgctaacgttagtcatcctcttcttaaatttttacgttcagacataccgaaaaaagccaatgaagaaagatatgcaagagccacctgcagggaaagaagtgaagaatggtttttccaaagcctacttcactgcagcaaatggagtgatgaacaagaaagcacaataa
Sequence Length
891
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
34,585 Da
NCBI Official Full Name
Homo sapiens elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 2, mRNA
NCBI Official Synonym Full Names
ELOVL fatty acid elongase 2
NCBI Official Symbol
ELOVL2
NCBI Official Synonym Symbols
SSC2
NCBI Protein Information
elongation of very long chain fatty acids protein 2
UniProt Protein Name
Elongation of very long chain fatty acids protein 2
Protein Family
UniProt Gene Name
ELOVL2
UniProt Synonym Gene Names
ELOVL FA elongase 2
UniProt Entry Name
ELOV2_HUMAN
Uniprot Description
ELOVL2: Condensing enzyme that catalyzes the synthesis of polyunsaturated very long chain fatty acid (C20- and C22-PUFA). Acts specifically toward polyunsaturated acyl-CoA with the higher activity toward C20:4(n-6) acyl-CoA. Belongs to the ELO family.
Protein type: Membrane protein, multi-pass; Membrane protein, integral; Lipid Metabolism - unsaturated fatty acid biosynthesis; EC 2.3.1.199
Chromosomal Location of Human Ortholog: 6p24.2
Cellular Component: endoplasmic reticulum; endoplasmic reticulum membrane; integral to endoplasmic reticulum membrane
Molecular Function: fatty acid elongase activity; protein binding
Biological Process: fatty acid elongation, saturated fatty acid; linoleic acid metabolic process; sphingolipid biosynthetic process; very-long-chain fatty acid biosynthetic process
Research Articles on ELOVL2
Similar Products
Product Notes
The ELOVL2 elovl2 (Catalog #AAA1270480) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaacatc taaaggcctt tgatgatgaa atcaatgctt ttttggacaa tatgtttgga ccgcgagatt ctcgagtcag agggtggttc atgttggact cttaccttcc tacctttttt cttactgtca tgtatctgct ctcaatatgg ctgggtaaca agtatatgaa gaacagacct gctctttctc tcaggggtat cctcaccttg tataatcttg gaatcacact tctatccgcg tacatgctgg cagagctcat tctctccact tgggaaggag gctacaactt acagtgtcaa gatcttacca gcgcagggga agctgacatc cgggtagcca aggtgctttg gtggtactat ttctccaaat cagtagagtt cctggacaca attttcttcg ttttgcggaa aaaaacgagt cagattactt ttcttcatgt atatcatcat gcttctatgt ttaacatctg gtggtgtgtc ttgaactgga taccttgtgg acaaagtttc tttggaccaa cactgaacag ttttatccac attcttatgt actcctacta tggactttct gtgtttccat ctatgcacaa gtatctttgg tggaagaaat atctcacaca ggctcagctg gtgcagttcg tgctcgccat cacgcacacc atgagcgccg tcgtgaaacc gtgtggcttc cccttcggtt gtctcatctt ccagtcatct tatatgctaa cgttagtcat cctcttctta aatttttacg ttcagacata ccgaaaaaag ccaatgaaga aagatatgca agagccacct gcagggaaag aagtgaagaa tggtttttcc aaagcctact tcactgcagc aaatggagtg atgaacaaga aagcacaata a. It is sometimes possible for the material contained within the vial of "ELOVL2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
