ELAVL3 cdna clone
ELAVL3 cDNA Clone
Gene Names
ELAVL3; HUC; HUCL; PLE21
Synonyms
ELAVL3; ELAVL3 cDNA Clone; ELAVL3 cdna clone
Sequence
atggtcactcagatactgggggccatggagtctcaggtgggggggggcccggccggcccggccctgcccaacgggccactccttggtacaaatggagccactgacgacagcaagaccaacctcatcgtcaactacctgccccagaacatgacccaggatgagttcaagagtctcttcggcagcattggcgacatcgagtcctgcaagttggttcgggacaagatcacagggcagagccttggctacgggtttgtgaactattctgaccccaatgatgcagacaaagccatcaacaccctcaacggcctcaaattacagacgaagaccatcaaggtgtcctatgccagacccagttcagcatccatccgggatgctaacctgtacgtcagcgggctccccaagaccatgagccagaaagagatggagcagctcttctcccagtacggccgcatcatcacgtcccgcatcctggtggaccaggtcacaggtgtctctcggggtgtgggattcatccgctttgacaagaggattgaggccgaagaggctatcaaaggactgaatgggcagaagccgctgggcgcagctgagcccatcacagtcaagttcgcgaacaacccaagtcagaagacggggcaggcgctgctcacccacctctaccagtcatccgcccggcgctacgcaggccccctacaccatcagacccagcgtttccggctggacaatttgctcaacatggcctacggcgtcaagagtcccctgtcgctcatcgccaggttctcgccgatcgccatcgatggtatgagcggcctggcgggcgtgggcctgtcggggggcgcggcgggcgccggctggtgcatcttcgtgtacaacctgtcaccggaggcagacgagagcgtgctgtggcagctgttcgggccttttggggcagtcaccaacgtcaaggtcatccgtgatttcaccaccaacaagtgcaagggtttcggcttcgtgaccatgaccaactatgacgaggcggccatggccatcgccagcctgaacggctatcgcctgggcgagcgcgtgctgcaggtctccttcaagaccagcaaacagcacaaggcgtga
Sequence Length
1104
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
38,865 Da
NCBI Official Full Name
Homo sapiens ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C), mRNA
NCBI Official Synonym Full Names
ELAV like RNA binding protein 3
NCBI Official Symbol
ELAVL3
NCBI Official Synonym Symbols
HUC; HUCL; PLE21
NCBI Protein Information
ELAV-like protein 3
UniProt Protein Name
ELAV-like protein 3
Protein Family
UniProt Gene Name
ELAVL3
UniProt Synonym Gene Names
HUC; PLE21; HuC
UniProt Entry Name
ELAV3_HUMAN
NCBI Description
A member of the ELAVL protein family, ELAV-like 3 is a neural-specific RNA-binding protein which contains three RNP-type RNA recognition motifs. The observation that ELAVL3 is one of several Hu antigens (neuronal-specific RNA-binding proteins) recognized by the anti-Hu serum antibody present in sera from patients with paraneoplastic encephalomyelitis and sensory neuronopathy (PEM/PSN) suggests it has a role in neurogenesis. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Uniprot Description
ELAVL3: Binds to AU-rich sequences (AREs) of target mRNAs, including VEGF mRNA. May also bind poly-A tracts via RRM 3. May be involved in neuronal differentiation and maintenance. Belongs to the RRM elav family. 2 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 19p13.2
Molecular Function: AU-rich element binding
Research Articles on ELAVL3
Similar Products
Product Notes
The ELAVL3 elavl3 (Catalog #AAA1272097) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtcactc agatactggg ggccatggag tctcaggtgg gggggggccc ggccggcccg gccctgccca acgggccact ccttggtaca aatggagcca ctgacgacag caagaccaac ctcatcgtca actacctgcc ccagaacatg acccaggatg agttcaagag tctcttcggc agcattggcg acatcgagtc ctgcaagttg gttcgggaca agatcacagg gcagagcctt ggctacgggt ttgtgaacta ttctgacccc aatgatgcag acaaagccat caacaccctc aacggcctca aattacagac gaagaccatc aaggtgtcct atgccagacc cagttcagca tccatccggg atgctaacct gtacgtcagc gggctcccca agaccatgag ccagaaagag atggagcagc tcttctccca gtacggccgc atcatcacgt cccgcatcct ggtggaccag gtcacaggtg tctctcgggg tgtgggattc atccgctttg acaagaggat tgaggccgaa gaggctatca aaggactgaa tgggcagaag ccgctgggcg cagctgagcc catcacagtc aagttcgcga acaacccaag tcagaagacg gggcaggcgc tgctcaccca cctctaccag tcatccgccc ggcgctacgc aggcccccta caccatcaga cccagcgttt ccggctggac aatttgctca acatggccta cggcgtcaag agtcccctgt cgctcatcgc caggttctcg ccgatcgcca tcgatggtat gagcggcctg gcgggcgtgg gcctgtcggg gggcgcggcg ggcgccggct ggtgcatctt cgtgtacaac ctgtcaccgg aggcagacga gagcgtgctg tggcagctgt tcgggccttt tggggcagtc accaacgtca aggtcatccg tgatttcacc accaacaagt gcaagggttt cggcttcgtg accatgacca actatgacga ggcggccatg gccatcgcca gcctgaacgg ctatcgcctg ggcgagcgcg tgctgcaggt ctccttcaag accagcaaac agcacaaggc gtga. It is sometimes possible for the material contained within the vial of "ELAVL3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
