Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EIF4E cdna clone

EIF4E cDNA Clone

Gene Names
EIF4E; CBP; EIF4F; AUTS19; EIF4E1; eIF-4E; EIF4EL1
Synonyms
EIF4E; EIF4E cDNA Clone; EIF4E cdna clone
Ordering
For Research Use Only!
Sequence Positions
1-115. Full length.
Sequence
atggcgactgtcgaaccggaaaccacccctactcctaatcccccgactacagaagaggagaaaacggaatctaatcaggaggttgctaacccagaacactatattaaacatcccctacagaacagatgggcactctggttttttaaaaatgataaaagcaaaacttggcaagcaaacctgcggctgatctccaagtttgatactgttgaagacttttgggctctgtacaaccatatccagctgtctagtaatttaatgcctggctgtgactactcactttttaaggatggtattgagcctatgtgggaagatgagaaaaacaaacggggaggacgatggctaattacattgaacaaacagcagagacgaagtgacctcaatcgcttttggctagagacacttctgtgccttattggagaatcttttgatgactacagtgatgatgtatgtggcgctgttgttaatgttagagctaaaggtgataagatagcaatatggactactgaatgtgaaaacagagaagctgttacacatatagggagggtatacaaggaaaggttaggacttcctccaaagatagtgattggttatcagtcccacgcagacacagctactaagagcggctccaccactaaaaataggtttgttgtttaa
Sequence Length
654
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
25,097 Da
NCBI Official Full Name
Homo sapiens eukaryotic translation initiation factor 4E, mRNA
NCBI Official Synonym Full Names
eukaryotic translation initiation factor 4E
NCBI Official Symbol
EIF4E
NCBI Official Synonym Symbols
CBP; EIF4F; AUTS19; EIF4E1; eIF-4E; EIF4EL1
NCBI Protein Information
eukaryotic translation initiation factor 4E
UniProt Protein Name
Eukaryotic translation initiation factor 4E
UniProt Gene Name
EIF4E
UniProt Synonym Gene Names
EIF4EL1; EIF4F; eIF-4E; eIF4E
UniProt Entry Name
IF4E_HUMAN

NCBI Description

The protein encoded by this gene is a component of the eukaryotic translation initiation factor 4F complex, which recognizes the 7-methylguanosine cap structure at the 5' end of messenger RNAs. The encoded protein aids in translation initiation by recruiting ribosomes to the 5'-cap structure. Association of this protein with the 4F complex is the rate-limiting step in translation initiation. This gene acts as a proto-oncogene, and its expression and activation is associated with transformation and tumorigenesis. Several pseudogenes of this gene are found on other chromosomes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]

Uniprot Description

EIF4E: a protein of the eukaryotic initiation factor 4E family. Recognizes and binds the 7-methylguanosine-containing mRNA cap during an early step in the initiation of protein synthesis and facilitates ribosome binding by inducing the unwinding of the mRNAs secondary structures. Phosphorylation increases the ability of the protein to bind to mRNA caps and to form the EIF4F complex.

Protein type: Translation; Translation initiation

Chromosomal Location of Human Ortholog: 4q23

Cellular Component: cytoplasm; cytosol; eukaryotic translation initiation factor 4F complex; mRNA cap complex; perinuclear region of cytoplasm; stress granule

Molecular Function: enzyme binding; eukaryotic initiation factor 4G binding; protein binding; RNA cap binding; translation initiation factor activity

Biological Process: G1/S transition of mitotic cell cycle; mRNA export from nucleus; negative regulation of autophagy; poly(A) tail shortening; positive regulation of mitotic cell cycle; regulation of translation; RNA export from nucleus; translational initiation

Disease: Autism, Susceptibility To, 19

Research Articles on EIF4E

Similar Products

Product Notes

The EIF4E eif4e (Catalog #AAA1266653) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The immunogen sequence is 1-115. Full length. The amino acid sequence is listed below: atggcgactg tcgaaccgga aaccacccct actcctaatc ccccgactac agaagaggag aaaacggaat ctaatcagga ggttgctaac ccagaacact atattaaaca tcccctacag aacagatggg cactctggtt ttttaaaaat gataaaagca aaacttggca agcaaacctg cggctgatct ccaagtttga tactgttgaa gacttttggg ctctgtacaa ccatatccag ctgtctagta atttaatgcc tggctgtgac tactcacttt ttaaggatgg tattgagcct atgtgggaag atgagaaaaa caaacgggga ggacgatggc taattacatt gaacaaacag cagagacgaa gtgacctcaa tcgcttttgg ctagagacac ttctgtgcct tattggagaa tcttttgatg actacagtga tgatgtatgt ggcgctgttg ttaatgttag agctaaaggt gataagatag caatatggac tactgaatgt gaaaacagag aagctgttac acatataggg agggtataca aggaaaggtt aggacttcct ccaaagatag tgattggtta tcagtcccac gcagacacag ctactaagag cggctccacc actaaaaata ggtttgttgt ttaa. It is sometimes possible for the material contained within the vial of "EIF4E, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.