Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EIF4A1 cdna clone

EIF4A1 cDNA Clone

Gene Names
EIF4A1; DDX2A; EIF4A; EIF-4A; eIF4A-I; eIF-4A-I
Synonyms
EIF4A1; EIF4A1 cDNA Clone; EIF4A1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtctgcgagccaggattcccgatccagagacaatggccccgatgggatggagcccgaaggcgtcatcgagagtaactggaatgagattgttgacagctttgatgacatgaacctctcggagtcccttctccgtggcatctacgcctatggttttgagaagccctctgccatccagcagcgagccattctaccttgtatcaagggttatgatgtgattgctcaagcccaatctgggactgggaaaacggccacatttgccatatcaattctgcagcagattgaattagatctaaaagccacccaggccttggtcctagcacccactcgagaattggctcagcagatacagaaggtggtcatggcactaggagactacatgggcgcctcctgtcacgcctgtatcgggggcaccaacgtgcgtgctgaggtgcagaaactgcagatggaagctccccacatcatcgtgggtacccctggccgtgtgtttgatatgcttaaccggagatacctgtcccccaaatacatcaagatgtttgtactggatgaagctgacgaaatgttaagccgtggattcaaggaccagatctatgacatattccaaaagctcaacagcaacacccaggtagttttgctgtcagccacaatgccttctgatgtgcttgaggtgaccaagaagttcatgagggaccccattcggattcttgtcaagaaggaagagttgaccctggagggtatccgccagttctacatcaacgtggaacgagaggagtggaagctggacacactatgtgacttgtatgaaaccctgaccatcacccaggcagtcatcttcatcaacacccggaggaaggtggactggctcaccgagaagatgcatgctcgagatttcactgtatccgccatgcatggagatatggaccaaaaggaacgagacgtgattatgagggagtttcgttctggctctagcagagttttgattaccactgacctgctggccagaggcattgatgtgcagcaggtttctttagtcatcaactatgaccttcccaccaacagggaaaactatatccacagaatcggtcgaggtggacggtttggccgtaaaggtgtggctattaacatggtgacagaagaagacaagaggactcttcgagacattgagaccttctacaacacctccattgaggaaatgcccctcaatgttgctgacctcatctga
Sequence Length
1221
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
39,548 Da
NCBI Official Full Name
Homo sapiens eukaryotic translation initiation factor 4A, isoform 1, mRNA
NCBI Official Synonym Full Names
eukaryotic translation initiation factor 4A1
NCBI Official Symbol
EIF4A1
NCBI Official Synonym Symbols
DDX2A; EIF4A; EIF-4A; eIF4A-I; eIF-4A-I
NCBI Protein Information
eukaryotic initiation factor 4A-I
UniProt Protein Name
Eukaryotic initiation factor 4A-I
UniProt Gene Name
EIF4A1
UniProt Synonym Gene Names
DDX2A; EIF4A; eIF-4A-I; eIF4A-I
UniProt Entry Name
IF4A1_HUMAN

Research Articles on EIF4A1

Similar Products

Product Notes

The EIF4A1 eif4a1 (Catalog #AAA1269859) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctgcga gccaggattc ccgatccaga gacaatggcc ccgatgggat ggagcccgaa ggcgtcatcg agagtaactg gaatgagatt gttgacagct ttgatgacat gaacctctcg gagtcccttc tccgtggcat ctacgcctat ggttttgaga agccctctgc catccagcag cgagccattc taccttgtat caagggttat gatgtgattg ctcaagccca atctgggact gggaaaacgg ccacatttgc catatcaatt ctgcagcaga ttgaattaga tctaaaagcc acccaggcct tggtcctagc acccactcga gaattggctc agcagataca gaaggtggtc atggcactag gagactacat gggcgcctcc tgtcacgcct gtatcggggg caccaacgtg cgtgctgagg tgcagaaact gcagatggaa gctccccaca tcatcgtggg tacccctggc cgtgtgtttg atatgcttaa ccggagatac ctgtccccca aatacatcaa gatgtttgta ctggatgaag ctgacgaaat gttaagccgt ggattcaagg accagatcta tgacatattc caaaagctca acagcaacac ccaggtagtt ttgctgtcag ccacaatgcc ttctgatgtg cttgaggtga ccaagaagtt catgagggac cccattcgga ttcttgtcaa gaaggaagag ttgaccctgg agggtatccg ccagttctac atcaacgtgg aacgagagga gtggaagctg gacacactat gtgacttgta tgaaaccctg accatcaccc aggcagtcat cttcatcaac acccggagga aggtggactg gctcaccgag aagatgcatg ctcgagattt cactgtatcc gccatgcatg gagatatgga ccaaaaggaa cgagacgtga ttatgaggga gtttcgttct ggctctagca gagttttgat taccactgac ctgctggcca gaggcattga tgtgcagcag gtttctttag tcatcaacta tgaccttccc accaacaggg aaaactatat ccacagaatc ggtcgaggtg gacggtttgg ccgtaaaggt gtggctatta acatggtgac agaagaagac aagaggactc ttcgagacat tgagaccttc tacaacacct ccattgagga aatgcccctc aatgttgctg acctcatctg a. It is sometimes possible for the material contained within the vial of "EIF4A1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.