Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EIF3G cdna clone

EIF3G cDNA Clone

Gene Names
EIF3G; EIF3S4; EIF3-P42; eIF3-p44; eIF3-delta
Synonyms
EIF3G; EIF3G cDNA Clone; EIF3G cdna clone
Ordering
For Research Use Only!
Sequence
atgcctactggagactttgattcgaagcccagttgggccgaccaggtggaggaggagggggaggacgacaaatgtgtcaccagcgagctcctcaaggggatccctctggccacaggtgacaccagcccagagccagagctactgccgggagctccactgccgcctcccaaggaggtcatcaacggaaacataaagacagtgacagagtacaagatagatgaggatggcaagaagttcaagattgtccgcaccttcaggattgagacccggaaggcttcaaaggctgtcgcaaggaggaagaactggaagaagttcgggaactcagagtttgacccccccggacccaatgtggccaccaccactgtcagtgacgatgtctctatgacgttcatcaccagcaaagaggacctgaactgccaggaggaggaggaccctatgaacaaactcaagggccagaagatcgtgtcctgccgcatctgcaagggcgaccactggaccacccgctgcccctacaaggatacgctggggcccatgcagaaggagctggccgagcagctgggcctgtctactggcgagaaggagaagctgccgggagagctagagccggtgcaggccacgcagaacaagacagggaagtatgtgccgccgagcctgcgcgacggggccagccgccgcggggagtccatgcagcccaaccgcagagccgacgacaacgccaccatccgtgtcaccaacttgtcagaggacacgcgtgagaccgacctgcaggagctcttccggcctttcggctctatctcccgcatctacctggctaaggacaagaccactggccaatccaagggctttgccttcatcagcttccaccgccgcgaggatgctgcgcgtgccattgccggggtgtccggctttggctacgaccacctcatcctcaacgtcgagtgggccaagccgtccaccaactaa
Sequence Length
963
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,611 Da
NCBI Official Full Name
Homo sapiens eukaryotic translation initiation factor 3, subunit G, mRNA
NCBI Official Synonym Full Names
eukaryotic translation initiation factor 3 subunit G
NCBI Official Symbol
EIF3G
NCBI Official Synonym Symbols
EIF3S4; EIF3-P42; eIF3-p44; eIF3-delta
NCBI Protein Information
eukaryotic translation initiation factor 3 subunit G
UniProt Protein Name
Eukaryotic translation initiation factor 3 subunit G
UniProt Gene Name
EIF3G
UniProt Synonym Gene Names
eIF3g; eIF-3 RNA-binding subunit
UniProt Entry Name
EIF3G_HUMAN

NCBI Description

This gene encodes a core subunit of the eukaryotic translation initiation factor 3 (eIF3) complex, which is required for initiation of protein translation. An N-terminal caspase cleavage product of the encoded protein may stimulate degradation of DNA. A mutation in this gene is associated with narcolepsy. [provided by RefSeq, Jul 2016]

Uniprot Description

eIF3-delta: eukaryotic translation initiation factor 3 subunit 4. Binds to the 40S ribosome and promotes the binding of methionyl-tRNAi and mRNA. This subunit binds to the 18S rRNA. eIF-3 is composed of at least 12 different subunits. Contains 1 RNA recognition motif (RRM) domain.

Protein type: RNA-binding; Translation initiation; Translation

Chromosomal Location of Human Ortholog: 19p13.2

Cellular Component: cytoplasm; cytosol; eukaryotic translation initiation factor 3 complex; nucleus

Molecular Function: protein binding; translation initiation factor activity

Biological Process: translational initiation

Research Articles on EIF3G

Similar Products

Product Notes

The EIF3G eif3g (Catalog #AAA1266992) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctactg gagactttga ttcgaagccc agttgggccg accaggtgga ggaggagggg gaggacgaca aatgtgtcac cagcgagctc ctcaagggga tccctctggc cacaggtgac accagcccag agccagagct actgccggga gctccactgc cgcctcccaa ggaggtcatc aacggaaaca taaagacagt gacagagtac aagatagatg aggatggcaa gaagttcaag attgtccgca ccttcaggat tgagacccgg aaggcttcaa aggctgtcgc aaggaggaag aactggaaga agttcgggaa ctcagagttt gacccccccg gacccaatgt ggccaccacc actgtcagtg acgatgtctc tatgacgttc atcaccagca aagaggacct gaactgccag gaggaggagg accctatgaa caaactcaag ggccagaaga tcgtgtcctg ccgcatctgc aagggcgacc actggaccac ccgctgcccc tacaaggata cgctggggcc catgcagaag gagctggccg agcagctggg cctgtctact ggcgagaagg agaagctgcc gggagagcta gagccggtgc aggccacgca gaacaagaca gggaagtatg tgccgccgag cctgcgcgac ggggccagcc gccgcgggga gtccatgcag cccaaccgca gagccgacga caacgccacc atccgtgtca ccaacttgtc agaggacacg cgtgagaccg acctgcagga gctcttccgg cctttcggct ctatctcccg catctacctg gctaaggaca agaccactgg ccaatccaag ggctttgcct tcatcagctt ccaccgccgc gaggatgctg cgcgtgccat tgccggggtg tccggctttg gctacgacca cctcatcctc aacgtcgagt gggccaagcc gtccaccaac taa. It is sometimes possible for the material contained within the vial of "EIF3G, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.