Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EIF2S2 cdna clone

EIF2S2 cDNA Clone

Gene Names
EIF2S2; EIF2; EIF2B; PPP1R67; EIF2beta; eIF-2-beta
Synonyms
EIF2S2; EIF2S2 cDNA Clone; EIF2S2 cdna clone
Ordering
For Research Use Only!
Sequence
atgtctggggacgagatgatttttgatcctactatgagcaagaagaaaaagaagaagaagaagccttttatgttagatgaggaaggggatacccaaacagaggaaacccagccttcagaaacaaaagaagtggagccagagccaactgaggacaaggatttggaagctgatgaagaggacactaggaaaaaagatgcttctgatgatctagatgacttgaacttctttaatcaaaagaaaaagaagaaaaaaactaaaaagatatttgatattgatgaagctgaagaaggtgtaaaggatcttaagattgaaagtgatgttcaagaaccaactgaaccagaggatgaccttgacattatgcttggcaataaaaagaagaaaaagaagaatgttaagttcccagatgaggatgaaatactagagaaagatgaagctctagaagatgaagacaacaaaaaagatgatggtatctcattcagtaatcagacaggccctgcttgggcaggctcagaaagagactacacatacgaggagctgctgaatcgagtgttcaacatcatgagggaaaagaatccagatatggttgctggggagaaaaggaaatttgtcatgaaacctccacaagtcgtccgagtaggaaccaagaaaacttcttttgtcaactttacagatatctgtaaactattacatcgtcagcccaaacatctccttgcatttttgttggctgaattgggtacaagtggttctatagatggtaataaccaacttgtaatcaaaggaagattccaacagaaacagatagaaaatgtcttgagaagatatatcaaggaatatgtcacttgtcacacatgccgatcaccggacacaatcctgcagaaggacacacgactctatttcctacagtgcgaaacttgtcattctagatgttctgttgccagtatcaaaaccggcttccaggctgtcacgggcaagcgagcacagctccgtgccaaagctaactaa
Sequence Length
1002
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
38,388 Da
NCBI Official Full Name
Homo sapiens eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa, mRNA
NCBI Official Synonym Full Names
eukaryotic translation initiation factor 2 subunit beta
NCBI Official Symbol
EIF2S2
NCBI Official Synonym Symbols
EIF2; EIF2B; PPP1R67; EIF2beta; eIF-2-beta
NCBI Protein Information
eukaryotic translation initiation factor 2 subunit 2
UniProt Protein Name
Eukaryotic translation initiation factor 2 subunit 2
UniProt Gene Name
EIF2S2
UniProt Synonym Gene Names
EIF2B; eIF-2-beta
UniProt Entry Name
IF2B_HUMAN

NCBI Description

Eukaryotic translation initiation factor 2 (EIF-2) functions in the early steps of protein synthesis by forming a ternary complex with GTP and initiator tRNA and binding to a 40S ribosomal subunit. EIF-2 is composed of three subunits, alpha, beta, and gamma, with the protein encoded by this gene representing the beta subunit. The beta subunit catalyzes the exchange of GDP for GTP, which recycles the EIF-2 complex for another round of initiation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]

Uniprot Description

eIF2-beta: a translational regulatory protein that functions in the early steps of protein synthesis by forming a ternary complex with GTP and initiator tRNA. This complex binds to a 40S ribosomal subunit, followed by mRNA binding to form a 43S preinitiation complex. Junction of the 60S ribosomal subunit to form the 80S initiation complex is preceded by hydrolysis of the GTP bound to eIF-2 and release of an eIF-2-GDP binary complex. In order for eIF-2 to recycle and catalyze another round of initiation, the GDP bound to eIF-2 must exchange with GTP by way of a reaction catalyzed by eIF-2B.

Protein type: Translation; Translation initiation

Chromosomal Location of Human Ortholog: 20q11.2

Cellular Component: cytoplasm; cytosol; eukaryotic translation initiation factor 2 complex; nucleus

Molecular Function: protein binding; RNA binding; translation factor activity, nucleic acid binding; translation initiation factor activity

Biological Process: translational initiation; transmembrane transport

Research Articles on EIF2S2

Similar Products

Product Notes

The EIF2S2 eif2s2 (Catalog #AAA1276291) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctgggg acgagatgat ttttgatcct actatgagca agaagaaaaa gaagaagaag aagcctttta tgttagatga ggaaggggat acccaaacag aggaaaccca gccttcagaa acaaaagaag tggagccaga gccaactgag gacaaggatt tggaagctga tgaagaggac actaggaaaa aagatgcttc tgatgatcta gatgacttga acttctttaa tcaaaagaaa aagaagaaaa aaactaaaaa gatatttgat attgatgaag ctgaagaagg tgtaaaggat cttaagattg aaagtgatgt tcaagaacca actgaaccag aggatgacct tgacattatg cttggcaata aaaagaagaa aaagaagaat gttaagttcc cagatgagga tgaaatacta gagaaagatg aagctctaga agatgaagac aacaaaaaag atgatggtat ctcattcagt aatcagacag gccctgcttg ggcaggctca gaaagagact acacatacga ggagctgctg aatcgagtgt tcaacatcat gagggaaaag aatccagata tggttgctgg ggagaaaagg aaatttgtca tgaaacctcc acaagtcgtc cgagtaggaa ccaagaaaac ttcttttgtc aactttacag atatctgtaa actattacat cgtcagccca aacatctcct tgcatttttg ttggctgaat tgggtacaag tggttctata gatggtaata accaacttgt aatcaaagga agattccaac agaaacagat agaaaatgtc ttgagaagat atatcaagga atatgtcact tgtcacacat gccgatcacc ggacacaatc ctgcagaagg acacacgact ctatttccta cagtgcgaaa cttgtcattc tagatgttct gttgccagta tcaaaaccgg cttccaggct gtcacgggca agcgagcaca gctccgtgcc aaagctaact aa. It is sometimes possible for the material contained within the vial of "EIF2S2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.