Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EIF2B4 cdna clone

EIF2B4 cDNA Clone

Gene Names
EIF2B4; EIF2B; EIF-2B; EIF2Bdelta
Synonyms
EIF2B4; EIF2B4 cDNA Clone; EIF2B4 cdna clone
Ordering
For Research Use Only!
Sequence
atggctgctgtggccgtggctgttcgcgaggactcgggatccgggatgaaggcggagcttccccctgggcctggggcagtggggagggaaatgaccaaagaagaaaagctgcagcttcggaaggaaaagaaacagcagaagaagaaacggaaggaagaaaagggggcagaaccagagactggctctgctgtatctgcagcccaatgtcaagtaggcccaaccagagaactgccagaatcgggcattcagttgggcactcctcgggagaaagttccagctggtcggagtaaggccgaacttcgggctgagcgtcgagccaagcaggaggccgagcgggccctgaaacaggcaagaaaaggggaacaaggaggaccacctcctaaggccagccccagcacagctggagaaaccccctcaggagtgaagcgtctccctgagtaccctcaggttgatgacctacttctgagaaggcttgttaaaaaaccagagcgtcaacaggttcctacacgaaaggattatggatccaaagtcagtctcttctctcacctaccccagtacagcagacaaaactctctgacccagtttatgagcatcccatcctctgtgatccacccagccatggtgcgactcggcctgcagtactcccagggcctggtcagtggctccaatgcccggtgtattgccctgcttcgtgccttgcagcaggtgattcaggattacacaacaccgcctaatgaagaactctccagggatctagtgaataaactaaaaccctacatgagcttcctgactcagtgccgtcccctgtcagcgagcatgcacaacgccatcaagttccttaacaaggaaatcaccagtgtgggcagttccaagcgggaagaggaggccaagtcagaacttcgagcagccattgatcggtatgtgcaagagaagattgtgctagcagctcaggcaatttcacgctttgcttaccagaagatcagtaatggagatgtgatcctggtatatggatgctcatctctggtatcacgaattcttcaggaggcttggacagagggccggcggtttcgggtggtagtggtggacagccggccatggctggaaggaaggcacacactacgttctctagtccatgctggtgtcccagcctcctacctgctgattcctgcagcctcctatgtgctcccagaggtttccaaggtgctattgggagctcatgcactcttggccaacgggtctgtgatgtcacgggtagggacagcacagttagccctggtggctcgagcccataatgtaccagtgctggtttgctgtgaaacatacaagttctgtgagcgtgtgcagactgatgcctttgtctctaatgagctagatgaccctgatgatctgcaatgtaagcggggagaacatgttgcgctggctaactggcagaaccacgcatccctacggttgttgaatctagtctatgatgtgactcccccagagcttgtggatctggtgatcacggagctggggatgatcccttgcagttctgtacctgttgttctacgagtcaagagcagtgaccagtga
Sequence Length
1572
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
57,458 Da
NCBI Official Full Name
Homo sapiens eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa, mRNA
NCBI Official Synonym Full Names
eukaryotic translation initiation factor 2B subunit delta
NCBI Official Symbol
EIF2B4
NCBI Official Synonym Symbols
EIF2B; EIF-2B; EIF2Bdelta
NCBI Protein Information
translation initiation factor eIF-2B subunit delta
UniProt Protein Name
Translation initiation factor eIF-2B subunit delta
UniProt Gene Name
EIF2B4
UniProt Synonym Gene Names
EIF2BD
UniProt Entry Name
EI2BD_HUMAN

NCBI Description

Eukaryotic initiation factor 2B (EIF2B), which is necessary for protein synthesis, is a GTP exchange factor composed of five different subunits. The protein encoded by this gene is the fourth, or delta, subunit. Defects in this gene are a cause of leukoencephalopathy with vanishing white matter (VWM) and ovarioleukodystrophy. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

eIF2B-delta: Catalyzes the exchange of eukaryotic initiation factor 2-bound GDP for GTP. Defects in EIF2B4 are a cause of leukodystrophy with vanishing white matter (VWM). VWM is a leukodystrophy that occurs mainly in children. Neurological signs include progressive cerebellar ataxia, spasticity, inconstant optic atrophy and relatively preserved mental abilities. The disease is chronic-progressive with, in most individuals, additional episodes of rapid deterioration following febrile infections or minor head trauma. While childhood onset is the most common form of the disorder, some severe forms are apparent at birth. A severe, early-onset form seen among the Cree and Chippewayan populations of Quebec and Manitoba is called Cree leukoencephalopathy. Milder forms may not become evident until adolescence or adulthood. Some females with milder forms of the disease who survive to adolescence exhibit ovarian dysfunction. This variant of the disorder is called ovarioleukodystrophy. Belongs to the eIF-2B alpha/beta/delta subunits family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Motility/polarity/chemotaxis; Translation initiation; Translation

Chromosomal Location of Human Ortholog: 2p23.3

Cellular Component: cytoplasm; cytosol; eukaryotic translation initiation factor 2B complex

Molecular Function: guanyl-nucleotide exchange factor activity; protein binding; S-methyl-5-thioribose-1-phosphate isomerase activity; translation initiation factor activity; translation initiation factor binding

Biological Process: cellular response to stimulus; methionine salvage; myelination; negative regulation of translation initiation in response to stress; negative regulation of translational initiation; oligodendrocyte development; ovarian follicle development; response to glucose stimulus; response to heat; response to peptide hormone stimulus; translational initiation

Disease: Leukoencephalopathy With Vanishing White Matter

Research Articles on EIF2B4

Similar Products

Product Notes

The EIF2B4 eif2b4 (Catalog #AAA1271935) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgctg tggccgtggc tgttcgcgag gactcgggat ccgggatgaa ggcggagctt ccccctgggc ctggggcagt ggggagggaa atgaccaaag aagaaaagct gcagcttcgg aaggaaaaga aacagcagaa gaagaaacgg aaggaagaaa agggggcaga accagagact ggctctgctg tatctgcagc ccaatgtcaa gtaggcccaa ccagagaact gccagaatcg ggcattcagt tgggcactcc tcgggagaaa gttccagctg gtcggagtaa ggccgaactt cgggctgagc gtcgagccaa gcaggaggcc gagcgggccc tgaaacaggc aagaaaaggg gaacaaggag gaccacctcc taaggccagc cccagcacag ctggagaaac cccctcagga gtgaagcgtc tccctgagta ccctcaggtt gatgacctac ttctgagaag gcttgttaaa aaaccagagc gtcaacaggt tcctacacga aaggattatg gatccaaagt cagtctcttc tctcacctac cccagtacag cagacaaaac tctctgaccc agtttatgag catcccatcc tctgtgatcc acccagccat ggtgcgactc ggcctgcagt actcccaggg cctggtcagt ggctccaatg cccggtgtat tgccctgctt cgtgccttgc agcaggtgat tcaggattac acaacaccgc ctaatgaaga actctccagg gatctagtga ataaactaaa accctacatg agcttcctga ctcagtgccg tcccctgtca gcgagcatgc acaacgccat caagttcctt aacaaggaaa tcaccagtgt gggcagttcc aagcgggaag aggaggccaa gtcagaactt cgagcagcca ttgatcggta tgtgcaagag aagattgtgc tagcagctca ggcaatttca cgctttgctt accagaagat cagtaatgga gatgtgatcc tggtatatgg atgctcatct ctggtatcac gaattcttca ggaggcttgg acagagggcc ggcggtttcg ggtggtagtg gtggacagcc ggccatggct ggaaggaagg cacacactac gttctctagt ccatgctggt gtcccagcct cctacctgct gattcctgca gcctcctatg tgctcccaga ggtttccaag gtgctattgg gagctcatgc actcttggcc aacgggtctg tgatgtcacg ggtagggaca gcacagttag ccctggtggc tcgagcccat aatgtaccag tgctggtttg ctgtgaaaca tacaagttct gtgagcgtgt gcagactgat gcctttgtct ctaatgagct agatgaccct gatgatctgc aatgtaagcg gggagaacat gttgcgctgg ctaactggca gaaccacgca tccctacggt tgttgaatct agtctatgat gtgactcccc cagagcttgt ggatctggtg atcacggagc tggggatgat cccttgcagt tctgtacctg ttgttctacg agtcaagagc agtgaccagt ga. It is sometimes possible for the material contained within the vial of "EIF2B4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.