Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EIF2AK4 cdna clone

EIF2AK4 cDNA Clone

Gene Names
EIF2AK4; GCN2; PVOD2
Synonyms
EIF2AK4; EIF2AK4 cDNA Clone; EIF2AK4 cdna clone
Ordering
For Research Use Only!
Sequence
atgattcaccgggatttgaagcctgtcaacatttttttggattctgatgaccatgtgaaaataggtgattttggtttggcgacagaccatctagccttttctgctgacagcaaacaagacgatcagacaggagacttgattaagtcagacccttcaggtcacttaactgggatggttggcactgctctctatgtaagcccagaggtccaaggaagcaccaaatctgcatacaaccagaaagtggatctcttcagcctgggaattatcttctttgagatgtcctatcaccccatggtcacggcttcagaaaggatctttgttctcaaccaactcagagatcccacttcgcctaagtttccagaagactttgacgatggagagcatgcaaagcagaaatcagtcatctcctggctgttgaaccacgatccagcaaaacggcccacagccacagaactgctcaagagtgagctgctgcccccaccccagatggaggagtcagagctgcatgaagtgctgcaccacacgctgaccaacgtggatgggaaggcctaccgcaccatgatggcccagatcttctcgcagcgcatctcccctgccatcgattacacctatgacagcgacatactgaagggcaacttctcaatccgtacagccaagatgcagcagcatgtgtgtgaaaccatcatccgcatctttaaaagacatggagctgttcagttgtgtactccactactgcttccccgaaacagacaaatatatgagcacaacgaagctgccctattcatggaccacagcgggatgctggtgatgcttccttttgacctgcggatcccttttgcaagatatgtggcaagaaataatatattgaatttaaaacgatactgcatagaacgtgtgttcaggccgcgcaagttagatcgatttcatcccaaagaacttctggagtgtgcatttgatattgtcacttctaccaccaacagctttctgcccactgctgaaattatctacactatctatgaaatcatccaagagtttccagcacttcaggaaagaaattacagtatttatttgaaccataccatgttattgaaagcaatactcttacactgtgggatcccagaagataaactcagtcaagtctacattattctgtatgatgctgtgacagagaagctgacgaggagagaagtggaagctaaattttgtaatctgtctttgtcttctaatagtctgtgtcgactctacaagtttattgaacagaagggagatttgcaagatcttatgccaacaataaattcattaataaaacagaaaacaggtattgcacagttggtgaagtatggcttaaaagacctagaggaggttgttggactgttgaagaaactctgcatcaagttacaggtcttgatcaatttgggcttggtttacaaggtgcagcagcacaatggaatcatcttccagtttgtggctttcatcaaacgaaggcaaagggctgtacctgaaatcctcgcagctggaggcagatatgacctgctgattccccagtttagagggccacaagctctggggccagttcccactgccattggggtcagcatagctatagacaagatatctgctgctgtcctcaacatggaggaatctgttacaataagctcttgtgacctcctggttgtaagtgttggccagatgtctatgtccagggccatcaacctaacccagaaactctggacagcaggcatcacagcagaaatcatgtacgactggtcacagtcccaagaggaattacaagagtactgcagacatcatgaaatcacctatgtggcccttgtctcggataaagaaggaagccatgtcaaggttaagtctttcgagaaggaaaggcagacagagaagcgtgtgctggagactgaacttgtggaccatgtactgcagaaactgaggactaaagtcactgatgaaaggaatggcagagaagcttccgataatcttgcagtgcaaaatctgaaggggtcattttctaatgcttcaggtttgtttgaaatccatggagcaacagtggttcccattgtgagtgtgctagccccggagaagctgtcagccagcactaggaggcgctatgaaactcaggtacaaactcgacttcagacctcccttgccaacttacatcagaaaagcagtgaaattgaaattctggctgtggatctacccaaagaaacaatattacagtttttatcattagagtgggatgctgatgaacaggcatttaacacaactgtgaagcagctgctgtcacgcctgccaaagcaaagatacctcaaattagtctgtgatgaaatttataacatcaaagtagaaaaaaaggtgtctgtgctatttctgtacagctatagagatgactactacagaatcttattttaa
Sequence Length
2421
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
69,797 Da
NCBI Official Full Name
Homo sapiens eukaryotic translation initiation factor 2 alpha kinase 4, mRNA
NCBI Official Synonym Full Names
eukaryotic translation initiation factor 2 alpha kinase 4
NCBI Official Symbol
EIF2AK4
NCBI Official Synonym Symbols
GCN2; PVOD2
NCBI Protein Information
eIF-2-alpha kinase GCN2
UniProt Protein Name
eIF-2-alpha kinase GCN2
Protein Family
UniProt Gene Name
EIF2AK4
UniProt Entry Name
E2AK4_HUMAN

NCBI Description

This gene encodes a member of a family of kinases that phosphorylate the alpha subunit of eukaryotic translation initiation factor-2 (EIF2), resulting in the downregulaton of protein synthesis. The encoded protein responds to amino acid deprivation by binding uncharged transfer RNAs. It may also be activated by glucose deprivation and viral infection. Mutations in this gene have been found in individuals suffering from autosomal recessive pulmonary venoocclusive-disease-2. [provided by RefSeq, Mar 2014]

Uniprot Description

GCN2: a kinase of the PEK family. Phosphorylates and inhibits eukaryotic initiation factor (eIF)-2 alpha, providing an important protective mechanism during various cellular stress conditions including endoplasmic reticulum (ER) stress.

Protein type: Translation; Kinase, protein; EC 2.7.11.1; Protein kinase, Other; Protein kinase, Ser/Thr (non-receptor); Other group; PEK family; GCN2 subfamily

Chromosomal Location of Human Ortholog: 15q15.1

Cellular Component: polysome

Molecular Function: eukaryotic translation initiation factor 2alpha kinase activity; protein serine/threonine kinase activity; tRNA binding

Biological Process: cellular response to amino acid starvation; inhibition of CREB transcription factor; learning; long-term memory; negative regulation of neuron differentiation; negative regulation of translation initiation in response to stress; negative regulation of translational initiation; positive regulation of adaptive immune response; positive regulation of defense response to virus by host; protein amino acid autophosphorylation; protein amino acid phosphorylation; regulation of translational initiation; T cell activation during immune response; viral protein biosynthetic process

Disease: Pulmonary Venoocclusive Disease 2, Autosomal Recessive

Research Articles on EIF2AK4

Similar Products

Product Notes

The EIF2AK4 eif2ak4 (Catalog #AAA1268095) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgattcacc gggatttgaa gcctgtcaac atttttttgg attctgatga ccatgtgaaa ataggtgatt ttggtttggc gacagaccat ctagcctttt ctgctgacag caaacaagac gatcagacag gagacttgat taagtcagac ccttcaggtc acttaactgg gatggttggc actgctctct atgtaagccc agaggtccaa ggaagcacca aatctgcata caaccagaaa gtggatctct tcagcctggg aattatcttc tttgagatgt cctatcaccc catggtcacg gcttcagaaa ggatctttgt tctcaaccaa ctcagagatc ccacttcgcc taagtttcca gaagactttg acgatggaga gcatgcaaag cagaaatcag tcatctcctg gctgttgaac cacgatccag caaaacggcc cacagccaca gaactgctca agagtgagct gctgccccca ccccagatgg aggagtcaga gctgcatgaa gtgctgcacc acacgctgac caacgtggat gggaaggcct accgcaccat gatggcccag atcttctcgc agcgcatctc ccctgccatc gattacacct atgacagcga catactgaag ggcaacttct caatccgtac agccaagatg cagcagcatg tgtgtgaaac catcatccgc atctttaaaa gacatggagc tgttcagttg tgtactccac tactgcttcc ccgaaacaga caaatatatg agcacaacga agctgcccta ttcatggacc acagcgggat gctggtgatg cttccttttg acctgcggat cccttttgca agatatgtgg caagaaataa tatattgaat ttaaaacgat actgcataga acgtgtgttc aggccgcgca agttagatcg atttcatccc aaagaacttc tggagtgtgc atttgatatt gtcacttcta ccaccaacag ctttctgccc actgctgaaa ttatctacac tatctatgaa atcatccaag agtttccagc acttcaggaa agaaattaca gtatttattt gaaccatacc atgttattga aagcaatact cttacactgt gggatcccag aagataaact cagtcaagtc tacattattc tgtatgatgc tgtgacagag aagctgacga ggagagaagt ggaagctaaa ttttgtaatc tgtctttgtc ttctaatagt ctgtgtcgac tctacaagtt tattgaacag aagggagatt tgcaagatct tatgccaaca ataaattcat taataaaaca gaaaacaggt attgcacagt tggtgaagta tggcttaaaa gacctagagg aggttgttgg actgttgaag aaactctgca tcaagttaca ggtcttgatc aatttgggct tggtttacaa ggtgcagcag cacaatggaa tcatcttcca gtttgtggct ttcatcaaac gaaggcaaag ggctgtacct gaaatcctcg cagctggagg cagatatgac ctgctgattc cccagtttag agggccacaa gctctggggc cagttcccac tgccattggg gtcagcatag ctatagacaa gatatctgct gctgtcctca acatggagga atctgttaca ataagctctt gtgacctcct ggttgtaagt gttggccaga tgtctatgtc cagggccatc aacctaaccc agaaactctg gacagcaggc atcacagcag aaatcatgta cgactggtca cagtcccaag aggaattaca agagtactgc agacatcatg aaatcaccta tgtggccctt gtctcggata aagaaggaag ccatgtcaag gttaagtctt tcgagaagga aaggcagaca gagaagcgtg tgctggagac tgaacttgtg gaccatgtac tgcagaaact gaggactaaa gtcactgatg aaaggaatgg cagagaagct tccgataatc ttgcagtgca aaatctgaag gggtcatttt ctaatgcttc aggtttgttt gaaatccatg gagcaacagt ggttcccatt gtgagtgtgc tagccccgga gaagctgtca gccagcacta ggaggcgcta tgaaactcag gtacaaactc gacttcagac ctcccttgcc aacttacatc agaaaagcag tgaaattgaa attctggctg tggatctacc caaagaaaca atattacagt ttttatcatt agagtgggat gctgatgaac aggcatttaa cacaactgtg aagcagctgc tgtcacgcct gccaaagcaa agatacctca aattagtctg tgatgaaatt tataacatca aagtagaaaa aaaggtgtct gtgctatttc tgtacagcta tagagatgac tactacagaa tcttatttta a. It is sometimes possible for the material contained within the vial of "EIF2AK4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.