Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EIF1AD cdna clone

EIF1AD cDNA Clone

Gene Names
EIF1AD; haponin
Synonyms
EIF1AD; EIF1AD cDNA Clone; EIF1AD cdna clone
Ordering
For Research Use Only!
Sequence
atgtctcaggccaccaagaggaagcatgtggtgaaggaggtgctaggggagcacatagtgccctccaaccagcagcagattgtcagggtactcaggaccccagggaacaatctgcatgaggtggagacagcccaagggcagcgcttcctggtgagcatgccctccaaataccgcaagaacatctggatcaagagaggggactttctcattgttgaccccattgaagagggagaaaaggtgaaggctgaaatctcgtttgtgctctgcaaggaccacgtgcgctctctgcagaaggaggggttttggcctgaggccttctctgaagtggctgagaaacacaacaacaggaacagacaaactcaaccagaactcccagctgagccacagttatcaggagaggagtccagctcagaagatgattctgacctgtttgttaacacaaaccgcagacagtatcatgagagtgaggaggagagtgaagaggaggaggcagcctga
Sequence Length
498
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
19,053 Da
NCBI Official Full Name
Homo sapiens eukaryotic translation initiation factor 1A domain containing, mRNA
NCBI Official Synonym Full Names
eukaryotic translation initiation factor 1A domain containing
NCBI Official Symbol
EIF1AD
NCBI Official Synonym Symbols
haponin
NCBI Protein Information
probable RNA-binding protein EIF1AD
UniProt Protein Name
Probable RNA-binding protein EIF1AD
UniProt Gene Name
EIF1AD
UniProt Entry Name
EIF1A_HUMAN

Uniprot Description

EIF1AD: Plays a role into cellular response to oxidative stress. Decreases cell proliferation. Belongs to the EIF1AD family.

Protein type: Translation; Translation initiation

Chromosomal Location of Human Ortholog: 11q13.1

Cellular Component: intermediate filament cytoskeleton; intracellular membrane-bound organelle; nucleoplasm

Molecular Function: protein binding

Research Articles on EIF1AD

Similar Products

Product Notes

The EIF1AD eif1ad (Catalog #AAA1266618) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctcagg ccaccaagag gaagcatgtg gtgaaggagg tgctagggga gcacatagtg ccctccaacc agcagcagat tgtcagggta ctcaggaccc cagggaacaa tctgcatgag gtggagacag cccaagggca gcgcttcctg gtgagcatgc cctccaaata ccgcaagaac atctggatca agagagggga ctttctcatt gttgacccca ttgaagaggg agaaaaggtg aaggctgaaa tctcgtttgt gctctgcaag gaccacgtgc gctctctgca gaaggagggg ttttggcctg aggccttctc tgaagtggct gagaaacaca acaacaggaa cagacaaact caaccagaac tcccagctga gccacagtta tcaggagagg agtccagctc agaagatgat tctgacctgt ttgttaacac aaaccgcaga cagtatcatg agagtgagga ggagagtgaa gaggaggagg cagcctga. It is sometimes possible for the material contained within the vial of "EIF1AD, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.