EFHA1 cdna clone
EFHA1 cDNA Clone
Gene Names
MICU2; EFHA1; 1110008L20Rik
Synonyms
EFHA1; EFHA1 cDNA Clone; EFHA1 cdna clone
Sequence
atggcggcggctgcgggtagctgcgcgcgggtggcggcctggggcggaaaactgcgacgggggctcgctgtcagccgacaggctgtgcggagtcccggccccttggcagcggcagtggccggcgcggccctggcaggagcaggagcggcctggcaccacagccgcgtcagtgttgcggcgcgggatggcagttttacagtctccgcacagaaaaatgttgaacatggaataatatatattgggaaaccgtctcttcgtaagcagcgcttcatgcagttttcttcactcgaacatgaaggagaatattatatgacaccacgagacttcctcttctcagtgatgtttgagcaaatggaacgtaaaacttcagtcaagaagctgacaaaaaaggacatcgaggatacactgtcagggatccaaacagctggctgtggatcaacttttttcagagaccttggcgataaagggctaatttcatataccgagtatcttttcttgcttacaatcctcactaaaccccattctggatttcatgttgcttttaaaatgctggatacagatggtaatgagatgattgaaaaaagggaattttttaagctgcagaagatcataagtaaacaagatgacttgatgacagtgaaaactaatgaaactggatatcaggaagcaatagtgaaagaacctgaaattaacacaactcttcagatgcgtttctttggaaaaagaggacaaagaaaacttcattataaagaatttcgaagatttatggaaaatttacaaacagagattcaagaaatggaattccttcagttttctaaaggtttgagtttcatgagaaaagaagactttgcagagtggctactttttttcactaacactgaaaataaagatatttattggaaaaatgtgagagagaagttgtcagcaggagagagcattagtttggatgaattcaagtcattttgccattttacaacccacttggaagactttgctattgccatgcagatgttcagtttagctcatcgtcctgtcagactagcggagtttaagagagctgtgaaagtagcaacaggacaagaactctcaaacaatattttggacactgtctttaagatctttgatttggatggtgatgaatgtcttagtcatgaagagtttcttggggtgttaaaaaacagaatgcatcgaggtttatgggtaccacaacatcagagtatacaagaatactggaagtgtgtgaagaaagaaagcattaaaggagtaaaagaagtctggaaacaagctggaaaaggtcttttttaa
Sequence Length
1305
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
49,666 Da
NCBI Official Full Name
Homo sapiens EF-hand domain family, member A1, mRNA
NCBI Official Synonym Full Names
mitochondrial calcium uptake 2
NCBI Official Symbol
MICU2
NCBI Official Synonym Symbols
EFHA1; 1110008L20Rik
NCBI Protein Information
calcium uptake protein 2, mitochondrial
UniProt Protein Name
Calcium uptake protein 2, mitochondrial
UniProt Gene Name
MICU2
UniProt Synonym Gene Names
EFHA1
UniProt Entry Name
MICU2_HUMAN
Uniprot Description
MICU2: Involved in mitochondrial uniporter-mediated calcium uptake. Probable regulator of the mitochondrial calcium uniporter (MCU). Component of a complex, at least composed of MCU, MICU1 and MICU2
Protein type: Calcium-binding; Mitochondrial
Chromosomal Location of Human Ortholog: 13q12.11
Cellular Component: mitochondrial inner membrane; mitochondrial intermembrane space; mitochondrion; nucleus
Molecular Function: protein binding; protein heterodimerization activity
Biological Process: mitochondrial calcium ion homeostasis; mitochondrial calcium ion transport; reduction of mitochondrial calcium ion concentration
Research Articles on EFHA1
Similar Products
Product Notes
The EFHA1 micu2 (Catalog #AAA1267452) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcgg ctgcgggtag ctgcgcgcgg gtggcggcct ggggcggaaa actgcgacgg gggctcgctg tcagccgaca ggctgtgcgg agtcccggcc ccttggcagc ggcagtggcc ggcgcggccc tggcaggagc aggagcggcc tggcaccaca gccgcgtcag tgttgcggcg cgggatggca gttttacagt ctccgcacag aaaaatgttg aacatggaat aatatatatt gggaaaccgt ctcttcgtaa gcagcgcttc atgcagtttt cttcactcga acatgaagga gaatattata tgacaccacg agacttcctc ttctcagtga tgtttgagca aatggaacgt aaaacttcag tcaagaagct gacaaaaaag gacatcgagg atacactgtc agggatccaa acagctggct gtggatcaac ttttttcaga gaccttggcg ataaagggct aatttcatat accgagtatc ttttcttgct tacaatcctc actaaacccc attctggatt tcatgttgct tttaaaatgc tggatacaga tggtaatgag atgattgaaa aaagggaatt ttttaagctg cagaagatca taagtaaaca agatgacttg atgacagtga aaactaatga aactggatat caggaagcaa tagtgaaaga acctgaaatt aacacaactc ttcagatgcg tttctttgga aaaagaggac aaagaaaact tcattataaa gaatttcgaa gatttatgga aaatttacaa acagagattc aagaaatgga attccttcag ttttctaaag gtttgagttt catgagaaaa gaagactttg cagagtggct actttttttc actaacactg aaaataaaga tatttattgg aaaaatgtga gagagaagtt gtcagcagga gagagcatta gtttggatga attcaagtca ttttgccatt ttacaaccca cttggaagac tttgctattg ccatgcagat gttcagttta gctcatcgtc ctgtcagact agcggagttt aagagagctg tgaaagtagc aacaggacaa gaactctcaa acaatatttt ggacactgtc tttaagatct ttgatttgga tggtgatgaa tgtcttagtc atgaagagtt tcttggggtg ttaaaaaaca gaatgcatcg aggtttatgg gtaccacaac atcagagtat acaagaatac tggaagtgtg tgaagaaaga aagcattaaa ggagtaaaag aagtctggaa acaagctgga aaaggtcttt tttaa. It is sometimes possible for the material contained within the vial of "EFHA1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
