Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EFCAB7 cdna clone

EFCAB7 cDNA Clone

Synonyms
EFCAB7; EFCAB7 cDNA Clone; EFCAB7 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgatcagtccacgaagcgatgcaactttctccagtcagaaatcaacaccttcagagagtcctcgaacaaagaaatttccactaactgaagaggaaatattttatatgaattgtagagctgcctacttaactgtcttcaaaagcagcttggaaaacattatttctaaagatcaactttacttagctcttcagcatgcaggaagaaatccatcccaaaagaccattaataagtattggactcctcaaactgccaaactgaattttgatgatttttgtataattttaaggaaggaaaaacctacttcaaaagcagaactactaaaatcttttaagcaattagatgtaaatgatgatggctgtattttacacactgacctttataaatttctaacaaagagaggtgagaagatgactcgagaagaagtaaatgccataataaatttggctgatgtaaatgctgatggcaaatttgactacatcaagttttgtaaattatatatgacaaccaacgagcaatgtctcaagactacactagaaaaactagaggttgacagtaaattgatgcgtcaccagtttggaaaccacatcgaagggtcccctgaaagggacccatcaccagtaccaaaaccatcacctaaaatcacaagaaaaactgatccagaaacattcttaaataaaggtgacaccaggagttctttactgtcagcaaccaggaagttcaaaacatctgtttccttcatagttaccatgggggctaatggtaaccgaaactcaaagttaacggagccaaatttaataaaggactggcaacacatgcaatcaaaaggttgcttcttcttagaagaagatggtgaaatcattagtcatcagtacaggatgcaaatagctcagaggtccatggtttatctaacaattaagccattaaacctgagtcaagttgaaggaaaaccatccccttggttatccgttgatactgccttgtatattctcaaggaaaatgagagtcaagcaaatctacagcttgtgtgttttaccgaactacgaaatagagaagtgtttggatggactggtgaactaggacctggaatttactggttaattccttccacaactggctgtaagctgaggaaaaaaataaaaccagtaacagatgaagcccaacttgtatatagagatgaaacaggggaattattccttacaaaggaatttaagtctactttatcagatatatttgaagtaattgatttagatggaaatggtcttcttagccttgaagaatataatttttttgaattgagaacaagtggtgagaaatgtgatgaagatgcttgggctgtctgcagagagaattttgatacaaagaggaatgaactaacaagacaaggatttatggatttgaatctaatggaagctaatgatcgagaaggagatccttgtgacctttgggtaactctacactctatgggctacaataaagctctggagttgacagaggcatgtccatttgtcattgatatctatgcagaaaaatgcaagccaaaaattaaagctgtccatatggaggcatgtagtggacaacttgagaaggccatttgtaaatctgttcttagcaacggtgatgccaaagtaatggatggctatgaaaatataatcgtgcatacttacagttgtgacacctggataacgtcagttattgaaaacaagtcagatgagaaagtgattattcacatcagcaatgagctaagtaaaaactgcataaacaacagaggactcaacatatttgcagtagaagtgggacccaaatctacaatggtttgtcaacatgtaatgcctttgaatgaacgacaagaatggatatattattgtatatattctcttatttcttaa
Sequence Length
1890
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
69,108 Da
NCBI Official Full Name
Homo sapiens EF-hand calcium binding domain 7, mRNA
NCBI Official Synonym Full Names
EF-hand calcium binding domain 7
NCBI Official Symbol
EFCAB7
NCBI Protein Information
EF-hand calcium-binding domain-containing protein 7
UniProt Protein Name
EF-hand calcium-binding domain-containing protein 7
UniProt Gene Name
EFCAB7
UniProt Synonym Gene Names
KIAA1799
UniProt Entry Name
EFCB7_HUMAN

Uniprot Description

EFCAB7: 2 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 1p31.3

Similar Products

Product Notes

The EFCAB7 efcab7 (Catalog #AAA1266522) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgatca gtccacgaag cgatgcaact ttctccagtc agaaatcaac accttcagag agtcctcgaa caaagaaatt tccactaact gaagaggaaa tattttatat gaattgtaga gctgcctact taactgtctt caaaagcagc ttggaaaaca ttatttctaa agatcaactt tacttagctc ttcagcatgc aggaagaaat ccatcccaaa agaccattaa taagtattgg actcctcaaa ctgccaaact gaattttgat gatttttgta taattttaag gaaggaaaaa cctacttcaa aagcagaact actaaaatct tttaagcaat tagatgtaaa tgatgatggc tgtattttac acactgacct ttataaattt ctaacaaaga gaggtgagaa gatgactcga gaagaagtaa atgccataat aaatttggct gatgtaaatg ctgatggcaa atttgactac atcaagtttt gtaaattata tatgacaacc aacgagcaat gtctcaagac tacactagaa aaactagagg ttgacagtaa attgatgcgt caccagtttg gaaaccacat cgaagggtcc cctgaaaggg acccatcacc agtaccaaaa ccatcaccta aaatcacaag aaaaactgat ccagaaacat tcttaaataa aggtgacacc aggagttctt tactgtcagc aaccaggaag ttcaaaacat ctgtttcctt catagttacc atgggggcta atggtaaccg aaactcaaag ttaacggagc caaatttaat aaaggactgg caacacatgc aatcaaaagg ttgcttcttc ttagaagaag atggtgaaat cattagtcat cagtacagga tgcaaatagc tcagaggtcc atggtttatc taacaattaa gccattaaac ctgagtcaag ttgaaggaaa accatcccct tggttatccg ttgatactgc cttgtatatt ctcaaggaaa atgagagtca agcaaatcta cagcttgtgt gttttaccga actacgaaat agagaagtgt ttggatggac tggtgaacta ggacctggaa tttactggtt aattccttcc acaactggct gtaagctgag gaaaaaaata aaaccagtaa cagatgaagc ccaacttgta tatagagatg aaacagggga attattcctt acaaaggaat ttaagtctac tttatcagat atatttgaag taattgattt agatggaaat ggtcttctta gccttgaaga atataatttt tttgaattga gaacaagtgg tgagaaatgt gatgaagatg cttgggctgt ctgcagagag aattttgata caaagaggaa tgaactaaca agacaaggat ttatggattt gaatctaatg gaagctaatg atcgagaagg agatccttgt gacctttggg taactctaca ctctatgggc tacaataaag ctctggagtt gacagaggca tgtccatttg tcattgatat ctatgcagaa aaatgcaagc caaaaattaa agctgtccat atggaggcat gtagtggaca acttgagaag gccatttgta aatctgttct tagcaacggt gatgccaaag taatggatgg ctatgaaaat ataatcgtgc atacttacag ttgtgacacc tggataacgt cagttattga aaacaagtca gatgagaaag tgattattca catcagcaat gagctaagta aaaactgcat aaacaacaga ggactcaaca tatttgcagt agaagtggga cccaaatcta caatggtttg tcaacatgta atgcctttga atgaacgaca agaatggata tattattgta tatattctct tatttcttaa. It is sometimes possible for the material contained within the vial of "EFCAB7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.