Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EEF1B2 cdna clone

EEF1B2 cDNA Clone

Gene Names
EEF1B2; EF1B; EEF1B; EEF1B1
Synonyms
EEF1B2; EEF1B2 cDNA Clone; EEF1B2 cdna clone
Ordering
For Research Use Only!
Sequence
atgggtttcggagacctgaaaagccctgccggcctccaggtgctcaacgattacctggcggacaagagctacatcgaggggtatgtgccatcacaagcagatgtggcagtatttgaagccgtgtccagcccaccgcctgccgacttgtgtcatgccctacgttggtataatcacatcaagtcttacgaaaaggaaaaggccagcctgccaggagtgaagaaagctttgggcaaatatggtcctgccgatgtggaagacactacaggaagtggagctacagatagtaaagatgatgatgacattgacctctttggatctgatgatgaggaggaaagtgaagaagcaaagaggctaagggaagaacgtcttgcacaatatgaatcaaagaaagccaaaaaacctgcacttgttgccaagtcttccatcttactagatgtgaaaccttgggatgatgagacagatatggcgaaattagaggagtgcgtcagaagcattcaagcagacggcttagtctggggctcatctaaactagttccagtgggatacggaattaagaaacttcaaatacagtgtgtagttgaagatgataaagttggaacagatatgctggaggagcagatcactgcttttgaggactatgtgcagtcgatggatgtggctgctttcaacaagatctaa
Sequence Length
678
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,764 Da
NCBI Official Full Name
Homo sapiens eukaryotic translation elongation factor 1 beta 2, mRNA
NCBI Official Synonym Full Names
eukaryotic translation elongation factor 1 beta 2
NCBI Official Symbol
EEF1B2
NCBI Official Synonym Symbols
EF1B; EEF1B; EEF1B1
NCBI Protein Information
elongation factor 1-beta
UniProt Protein Name
Elongation factor 1-beta
UniProt Gene Name
EEF1B2
UniProt Synonym Gene Names
EEF1B; EF1B; EF-1-beta
UniProt Entry Name
EF1B_HUMAN

NCBI Description

This gene encodes a translation elongation factor. The protein is a guanine nucleotide exchange factor involved in the transfer of aminoacylated tRNAs to the ribosome. Alternative splicing results in three transcript variants which differ only in the 5' UTR. [provided by RefSeq, Jul 2008]

Uniprot Description

eEF1B: EF-1-beta and EF-1-delta stimulate the exchange of GDP bound to EF-1-alpha to GTP. Belongs to the EF-1-beta/EF-1-delta family.

Protein type: Translation; Translation elongation

Chromosomal Location of Human Ortholog: 2q33.3

Cellular Component: cytoplasm; cytosol; endoplasmic reticulum; nucleus

Molecular Function: protein binding

Biological Process: translational elongation

Research Articles on EEF1B2

Similar Products

Product Notes

The EEF1B2 eef1b2 (Catalog #AAA1276581) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggtttcg gagacctgaa aagccctgcc ggcctccagg tgctcaacga ttacctggcg gacaagagct acatcgaggg gtatgtgcca tcacaagcag atgtggcagt atttgaagcc gtgtccagcc caccgcctgc cgacttgtgt catgccctac gttggtataa tcacatcaag tcttacgaaa aggaaaaggc cagcctgcca ggagtgaaga aagctttggg caaatatggt cctgccgatg tggaagacac tacaggaagt ggagctacag atagtaaaga tgatgatgac attgacctct ttggatctga tgatgaggag gaaagtgaag aagcaaagag gctaagggaa gaacgtcttg cacaatatga atcaaagaaa gccaaaaaac ctgcacttgt tgccaagtct tccatcttac tagatgtgaa accttgggat gatgagacag atatggcgaa attagaggag tgcgtcagaa gcattcaagc agacggctta gtctggggct catctaaact agttccagtg ggatacggaa ttaagaaact tcaaatacag tgtgtagttg aagatgataa agttggaaca gatatgctgg aggagcagat cactgctttt gaggactatg tgcagtcgat ggatgtggct gctttcaaca agatctaa. It is sometimes possible for the material contained within the vial of "EEF1B2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.