ECD cdna clone
ECD cDNA Clone
Gene Names
ECD; GCR2; SGT1; HSGT1
Synonyms
ECD; ECD cDNA Clone; ECD cdna clone
Sequence
atggaagaaaccatgaagcttgctacgatggaagacacagtggagtactgcctgttcctgataccagatgagtcaagggactcagataaacataaagagattcttcagaagtacattgagagaataatcactcggtttgcacctatgctggtcccctacatctggcagaatcagcctttcaatcttaaatataaacctgggaaaggaggtgttcctgctcatatgtttggcgtgacaaagtttggggataacattgaggatgaatggtttattgtttatgtaataaagcagatcacaaaggaatttccagagttagtagcaaggattgaagacaatgatggtgaattcttgttaatagaagctgctgactttctccctaaatggctggatcctgaaaatagcaccaatagggtatttttctgccatggggaattgtgtattatccctgcaccaagaaaatctggagcagaatcttggttacccaccacacccccaacaattccacaagcattgaatataatcacagcacattcagaaaaaatacttgcttcagaatctatacgagctgctgtgaataggcgcatcagagggtacccagaaaaaattcaggcctcacttcatcgagcacactgcttccttccagctggcattgtggcagtgctaaagcagcgccccagattggtggctgcagcagtccaggcattttacctacgagaccctattgacctgcgagcttgtcgtgttttcaagacattcttgcctgaaacacgaataatgacatcggtcacattcactaaatgtctatatgcacaattggtgcaacaaaggtttgtgccagaccggcggagtggatacaggctgcctcctccatctgatccccagtaccgagcccatgaattgggcatgaaattggctcatggatttgagatcttatgctccaaatgtagcccacatttttctgactgcaagaaatcccttgtgactgcctcaccactctgggccagtttccttgaaagtctgaaaaagaatgattactttaagggactgatagaaggttctgctcagtaccgggaaaggctagaaatggcagagaattacttccagctctcagtagactggccagaaagttctcttgctatgagccctggtgaagaaatcttaaccttattacagacaataccatttgatatagaagaccttaagaaagaagcagctaatcttcccccagaggatgatgaccagtggttagatctctcaccagatcagctggaccagctgctgcaggaagctgttggcaaaaaagaatccgagtctgtttccaaggaggagaaggagcagaactatgacttaactgaagtctcagagagcatgaaagctttcatatccaaagtctcaacccacaagggagcagagctgcctcgagaaccttctgaggctccaatcacttttgatgcagattcttttcttaattattttgataagattttagggccaaggcctaatgagtcagattctgatgatctggatgatgaagactttgaatgtttagatagtgatgatgacttggactttgaaacacacgaacctggcgaagaggcttccctgaaaggaacacttgataatctcaagtcatacatggcccagatggaccaggaactagcacacacctgcatcagcaaaagtttcaccactaggaaccaagtggaacctgtatcccagactaccgataacaattcagatgaggaagattctggtacgggagaatctgttatggcaccagtagatgtagacctgaacctggtttcaaatatattggaatcctatagctcccaagctggactggcaggacctgcttccaatcttttacaaagcatgggagtgcagctgcctgacaacaccgatcacagaccaacaagtaagccaacaaaaaattaa
Sequence Length
1935
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
76,508 Da
NCBI Official Full Name
Homo sapiens ecdysoneless homolog (Drosophila), mRNA
NCBI Official Synonym Full Names
ecdysoneless cell cycle regulator
NCBI Official Symbol
ECD
NCBI Official Synonym Symbols
GCR2; SGT1; HSGT1
NCBI Protein Information
protein ecdysoneless homolog
UniProt Protein Name
Protein ecdysoneless homolog
Protein Family
UniProt Gene Name
ECD
UniProt Synonym Gene Names
hSGT1
UniProt Entry Name
ECD_HUMAN
Uniprot Description
SGT1: Novel regulator of p53 stability and function. May also be a transcriptional activator required for the expression of glycolytic genes. Belongs to the SGT1 family.
Protein type: Transcription, coactivator/corepressor
Chromosomal Location of Human Ortholog: 10q22.3
Cellular Component: cytoplasm; nucleoplasm; nucleus
Molecular Function: histone acetyltransferase binding; protein binding; transcription coactivator activity
Biological Process: positive regulation of transcription from RNA polymerase II promoter; regulation of glycolysis; transcription from RNA polymerase II promoter
Research Articles on ECD
Similar Products
Product Notes
The ECD ecd (Catalog #AAA1271496) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaagaaa ccatgaagct tgctacgatg gaagacacag tggagtactg cctgttcctg ataccagatg agtcaaggga ctcagataaa cataaagaga ttcttcagaa gtacattgag agaataatca ctcggtttgc acctatgctg gtcccctaca tctggcagaa tcagcctttc aatcttaaat ataaacctgg gaaaggaggt gttcctgctc atatgtttgg cgtgacaaag tttggggata acattgagga tgaatggttt attgtttatg taataaagca gatcacaaag gaatttccag agttagtagc aaggattgaa gacaatgatg gtgaattctt gttaatagaa gctgctgact ttctccctaa atggctggat cctgaaaata gcaccaatag ggtatttttc tgccatgggg aattgtgtat tatccctgca ccaagaaaat ctggagcaga atcttggtta cccaccacac ccccaacaat tccacaagca ttgaatataa tcacagcaca ttcagaaaaa atacttgctt cagaatctat acgagctgct gtgaataggc gcatcagagg gtacccagaa aaaattcagg cctcacttca tcgagcacac tgcttccttc cagctggcat tgtggcagtg ctaaagcagc gccccagatt ggtggctgca gcagtccagg cattttacct acgagaccct attgacctgc gagcttgtcg tgttttcaag acattcttgc ctgaaacacg aataatgaca tcggtcacat tcactaaatg tctatatgca caattggtgc aacaaaggtt tgtgccagac cggcggagtg gatacaggct gcctcctcca tctgatcccc agtaccgagc ccatgaattg ggcatgaaat tggctcatgg atttgagatc ttatgctcca aatgtagccc acatttttct gactgcaaga aatcccttgt gactgcctca ccactctggg ccagtttcct tgaaagtctg aaaaagaatg attactttaa gggactgata gaaggttctg ctcagtaccg ggaaaggcta gaaatggcag agaattactt ccagctctca gtagactggc cagaaagttc tcttgctatg agccctggtg aagaaatctt aaccttatta cagacaatac catttgatat agaagacctt aagaaagaag cagctaatct tcccccagag gatgatgacc agtggttaga tctctcacca gatcagctgg accagctgct gcaggaagct gttggcaaaa aagaatccga gtctgtttcc aaggaggaga aggagcagaa ctatgactta actgaagtct cagagagcat gaaagctttc atatccaaag tctcaaccca caagggagca gagctgcctc gagaaccttc tgaggctcca atcacttttg atgcagattc ttttcttaat tattttgata agattttagg gccaaggcct aatgagtcag attctgatga tctggatgat gaagactttg aatgtttaga tagtgatgat gacttggact ttgaaacaca cgaacctggc gaagaggctt ccctgaaagg aacacttgat aatctcaagt catacatggc ccagatggac caggaactag cacacacctg catcagcaaa agtttcacca ctaggaacca agtggaacct gtatcccaga ctaccgataa caattcagat gaggaagatt ctggtacggg agaatctgtt atggcaccag tagatgtaga cctgaacctg gtttcaaata tattggaatc ctatagctcc caagctggac tggcaggacc tgcttccaat cttttacaaa gcatgggagt gcagctgcct gacaacaccg atcacagacc aacaagtaag ccaacaaaaa attaa. It is sometimes possible for the material contained within the vial of "ECD, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
