Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EBNA1BP2 cdna clone

EBNA1BP2 cDNA Clone

Gene Names
EBNA1BP2; P40; EBP2; NOBP
Synonyms
EBNA1BP2; EBNA1BP2 cDNA Clone; EBNA1BP2 cdna clone
Ordering
For Research Use Only!
Sequence
atggacactcccccgctctcggattcggagtcggaatccgatgaatcccttgtcacagacagagagttgcaggatgcgttttcccgagggcttctgaagccaggcctcaatgtcgtgctagaggggccgaagaaggccgtgaacgacgtgaatggcctgaagcaatgtttggcagaattcaagcgggatctggaatgggttgaaaggctcgatgtgacactgggtccggtaccggagatcggtggatctgaggcgccagcacctcagaacaaggaccagaaagctgttgatccagaagacgacttccagcgagagatgagtttctatcgccaagcccaggccgcagtgcttgcagtcttaccccgcctccatcagctcaaagtccctacgaagcgacccactgattattttgcggaaatggccaaatctgatctgcagatgcagaagattcgacagaagctgcagactaaacaggctgccatggagaggtctgaaaaagctaagcaactgcgagcacttaggaaatacgggaagaaggtgcaaacggaggttcttcagaagaggcagcaggagaaagcccatatgatgaatgctattaagaaatatcagaaaggcttctctgataaactggatttccttgagggagatcagaaacctctggcacagcgcaagaaggcaggagccaaaggccagcagatgaggaaggggcccagtgctaaacgacggtataaaaaccagaagtttggttttggtggaaagaagaaaggctcaaagtggaacactcgggagagctatgatgatgtatctagcttccgggccaagacagctcatggcagaggcctcaagaggcctggcaagaaagggtcaaataagagacctggaaaacgaacaagagagaagatgaagaacagaacacactaa
Sequence Length
921
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
34,852 Da
NCBI Official Full Name
Homo sapiens EBNA1 binding protein 2, mRNA
NCBI Official Synonym Full Names
EBNA1 binding protein 2
NCBI Official Symbol
EBNA1BP2
NCBI Official Synonym Symbols
P40; EBP2; NOBP
NCBI Protein Information
probable rRNA-processing protein EBP2
UniProt Protein Name
Probable rRNA-processing protein EBP2
UniProt Gene Name
EBNA1BP2
UniProt Synonym Gene Names
EBP2
UniProt Entry Name
EBP2_HUMAN

Uniprot Description

EBNA1BP2: Required for the processing of the 27S pre-rRNA. Belongs to the EBP2 family.

Protein type: Cell cycle regulation; RNA-binding; Nucleolus

Chromosomal Location of Human Ortholog: 1p35-p33

Cellular Component: nucleolus; nucleus

Biological Process: ribosomal large subunit biogenesis and assembly; rRNA processing

Research Articles on EBNA1BP2

Similar Products

Product Notes

The EBNA1BP2 ebna1bp2 (Catalog #AAA1273809) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacactc ccccgctctc ggattcggag tcggaatccg atgaatccct tgtcacagac agagagttgc aggatgcgtt ttcccgaggg cttctgaagc caggcctcaa tgtcgtgcta gaggggccga agaaggccgt gaacgacgtg aatggcctga agcaatgttt ggcagaattc aagcgggatc tggaatgggt tgaaaggctc gatgtgacac tgggtccggt accggagatc ggtggatctg aggcgccagc acctcagaac aaggaccaga aagctgttga tccagaagac gacttccagc gagagatgag tttctatcgc caagcccagg ccgcagtgct tgcagtctta ccccgcctcc atcagctcaa agtccctacg aagcgaccca ctgattattt tgcggaaatg gccaaatctg atctgcagat gcagaagatt cgacagaagc tgcagactaa acaggctgcc atggagaggt ctgaaaaagc taagcaactg cgagcactta ggaaatacgg gaagaaggtg caaacggagg ttcttcagaa gaggcagcag gagaaagccc atatgatgaa tgctattaag aaatatcaga aaggcttctc tgataaactg gatttccttg agggagatca gaaacctctg gcacagcgca agaaggcagg agccaaaggc cagcagatga ggaaggggcc cagtgctaaa cgacggtata aaaaccagaa gtttggtttt ggtggaaaga agaaaggctc aaagtggaac actcgggaga gctatgatga tgtatctagc ttccgggcca agacagctca tggcagaggc ctcaagaggc ctggcaagaa agggtcaaat aagagacctg gaaaacgaac aagagagaag atgaagaaca gaacacacta a. It is sometimes possible for the material contained within the vial of "EBNA1BP2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.