Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EBAG9 cdna clone

EBAG9 cDNA Clone

Gene Names
EBAG9; EB9; PDAF
Synonyms
EBAG9; EBAG9 cDNA Clone; EBAG9 cdna clone
Ordering
For Research Use Only!
Sequence
atggccatcacccagtttcggttatttaaattttgtacctgcctagcaacagtattctcattcctaaagagattaatatgcagatctggcagaggacggaaattaagtggagaccaaataactttgccaactacagttgattattcatcagttcctaagcagacagatgttgaagagtggacttcctgggatgaagatgcacccaccagtgtaaagatcgaaggagggaatgggaatgtggcaacacaacaaaattctttggaacaactggaacctgactattttaaggacatgacaccaactattaggaaaactcagaaaattgttattaagaagagagaaccattgaattttggcatcccagatgggagcacaggtttctctagtagattagcagctacacaagatctgccttttattcatcagtcttctgaattaggtgacttagatacctggcaggaaaataccaatgcatgggaagaagaagaagatgcagcctggcaagcagaagaagttctgagacagcagaaactagcagacagagaaaagagagcagccgaacaacaaaggaagaaaatggaaaaggaagcacaacggctaatgaagaaggaacaaaacaaaattggtgtgaaactttcataa
Sequence Length
642
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
29,466 Da
NCBI Official Full Name
Homo sapiens estrogen receptor binding site associated, antigen, 9, mRNA
NCBI Official Synonym Full Names
estrogen receptor binding site associated, antigen, 9
NCBI Official Symbol
EBAG9
NCBI Official Synonym Symbols
EB9; PDAF
NCBI Protein Information
receptor-binding cancer antigen expressed on SiSo cells
UniProt Protein Name
Receptor-binding cancer antigen expressed on SiSo cells
UniProt Gene Name
EBAG9
UniProt Synonym Gene Names
RCAS1
UniProt Entry Name
RCAS1_HUMAN

NCBI Description

This gene was identified as an estrogen-responsive gene. Regulation of transcription by estrogen is mediated by estrogen receptor, which binds to the estrogen-responsive element found in the 5'-flanking region of this gene. The encoded protein is a tumor-associated antigen that is expressed at high frequency in a variety of cancers. Alternate splicing results in multiple transcript variants. A pseudogene of this gene has been defined on chromosome 10. [provided by RefSeq, Jul 2013]

Uniprot Description

RCAS1: May participate in suppression of cell proliferation and induces apoptotic cell death through activation of interleukin-1- beta converting enzyme (ICE)-like proteases. Homodimer. By estrogen. Widely expressed. Expressed in ovary, testis, prostate, thymus, muscle and heart, but not in small intestine, colon, lymph nodes, or peripherical blood lymphocytes. The protein is not detected in any of the above organs.

Protein type: Apoptosis; Membrane protein, integral

Chromosomal Location of Human Ortholog: 8q23

Research Articles on EBAG9

Similar Products

Product Notes

The EBAG9 ebag9 (Catalog #AAA1269322) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccatca cccagtttcg gttatttaaa ttttgtacct gcctagcaac agtattctca ttcctaaaga gattaatatg cagatctggc agaggacgga aattaagtgg agaccaaata actttgccaa ctacagttga ttattcatca gttcctaagc agacagatgt tgaagagtgg acttcctggg atgaagatgc acccaccagt gtaaagatcg aaggagggaa tgggaatgtg gcaacacaac aaaattcttt ggaacaactg gaacctgact attttaagga catgacacca actattagga aaactcagaa aattgttatt aagaagagag aaccattgaa ttttggcatc ccagatggga gcacaggttt ctctagtaga ttagcagcta cacaagatct gccttttatt catcagtctt ctgaattagg tgacttagat acctggcagg aaaataccaa tgcatgggaa gaagaagaag atgcagcctg gcaagcagaa gaagttctga gacagcagaa actagcagac agagaaaaga gagcagccga acaacaaagg aagaaaatgg aaaaggaagc acaacggcta atgaagaagg aacaaaacaa aattggtgtg aaactttcat aa. It is sometimes possible for the material contained within the vial of "EBAG9, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.