Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EARS2 cdna clone

EARS2 cDNA Clone

Gene Names
EARS2; MSE1; gluRS; COXPD12
Synonyms
EARS2; EARS2 cDNA Clone; EARS2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcgctcctgaggagactgctgcagcgcgagaggccttcggcggcctctggccgccccgtaggacggcgcgaggccaacctgggcactgatgccggggttgcggtgcgagtgcggttcgctcccagccccacaggcttcttgcacctgggtggcctccgcactgccttgtacaactacatctttgctaagaagtaccaggggagcttcatcctgaggctagaggacacagatcagactcgcgttgtgcctggggcagcagagaatattgaggacatgctggagtgggcaggcatcccgcctgatgagagcccccgccggggcggtcctgctgggccctaccagcaatctcagcggttggagctgtatgcccaggccacagaagcgctgctgaagaccggagctgcttacccctgtttctgctcaccccagcggctggagctcctgaagaaggaggccttgcggaaccaccagacgccccggtatgacaatcggtgcaggaacatgagccaggagcaggtggcccagaagctggccaaggaccccaagcctgcgatccgcttccgcctggagcaggtggtgccagccttccaggacctggtgtatggctggaataggcatgaagtggccagcgtggagggagacccagtcatcatgaagagcgacggcttccccacataccacctggcctgcgtggtggacgaccaccacatgggcatcagccacgtgctgcgaggctctgagtggctcgtctccactgccaagcacctgctcctctaccaggccctgggctggcagccaccccacttcgcccacctgcccctgctcctcaacagggatggcagcaagctctccaagaggcaaggggacgttttcctggagcactttgctgctgatggcttcctgcccgattccttgttggacatcatcaccaactgtggctcaggttttgcagagaaccaaatgggcaggaccctgccggagctgatcacacagttcaacctgacacaggtcacctgtcactcagccctgctggacctggagaagctcccagaattcaacagactgcacctccagcggctggtgagcaatgagagccagaggcgccagctggtggggaagctgcaggtccttgtggaggaggcctttggttgccagctgcaaaacagggatgtcctcaacccagtctacgtggagaggatcctcctgctgagacagggtcacatttgccgcctgcaggacttggtgtccccagtatactcttacctgtggactcgccctgcagtaggtcgagcacagctggacgccatctcggagaaggtggatgtgattgccaagcgtgtgctggggcttctagaaagatctggtatgagcttaactcaggatatgctgaatggagaactgaagaagctatcagaaggtttggaaggcaccaagtacagtaatgtgatgaaactccttcggatggccctcagtggacagcaggtgaggcagggacacgggttggattgttccctggagcccctcattgatcctttgaacttacatttcctggcaggcactgagctcaatattgagtatacaaaggtgaatgaaacatga
Sequence Length
1605
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
59,989 Da
NCBI Official Full Name
Homo sapiens glutamyl-tRNA synthetase 2, mitochondrial (putative), mRNA
NCBI Official Synonym Full Names
glutamyl-tRNA synthetase 2, mitochondrial
NCBI Official Symbol
EARS2
NCBI Official Synonym Symbols
MSE1; gluRS; COXPD12
NCBI Protein Information
probable glutamate--tRNA ligase, mitochondrial
UniProt Protein Name
Probable glutamate--tRNA ligase, mitochondrial
UniProt Gene Name
EARS2
UniProt Synonym Gene Names
KIAA1970; GluRS
UniProt Entry Name
SYEM_HUMAN

NCBI Description

This gene encodes a member of the class I family of aminoacyl-tRNA synthetases. These enzymes play a critical role in protein biosynthesis by charging tRNAs with their cognate amino acids. This protein is encoded by the nuclear genome but is likely to be imported to the mitochondrion where it is thought to catalyze the ligation of glutamate to tRNA molecules. Mutations in this gene have been associated with combined oxidative phosphorylation deficiency 12 (COXPD12). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015]

Uniprot Description

EARS2: Catalyzes the attachment of glutamate to tRNA(Glu) in a two-step reaction: glutamate is first activated by ATP to form Glu-AMP and then transferred to the acceptor end of tRNA(Glu). Belongs to the class-I aminoacyl-tRNA synthetase family.

Protein type: Translation; Mitochondrial; EC 6.1.1.17; Ligase; Cofactor and Vitamin Metabolism - porphyrin and chlorophyll

Chromosomal Location of Human Ortholog: 16p12.2

Cellular Component: mitochondrion

Molecular Function: glutamate-tRNA ligase activity; glutamate-tRNA(Gln) ligase activity; RNA binding

Biological Process: glutamyl-tRNA aminoacylation

Disease: Combined Oxidative Phosphorylation Deficiency 12

Research Articles on EARS2

Similar Products

Product Notes

The EARS2 ears2 (Catalog #AAA1271272) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcgc tcctgaggag actgctgcag cgcgagaggc cttcggcggc ctctggccgc cccgtaggac ggcgcgaggc caacctgggc actgatgccg gggttgcggt gcgagtgcgg ttcgctccca gccccacagg cttcttgcac ctgggtggcc tccgcactgc cttgtacaac tacatctttg ctaagaagta ccaggggagc ttcatcctga ggctagagga cacagatcag actcgcgttg tgcctggggc agcagagaat attgaggaca tgctggagtg ggcaggcatc ccgcctgatg agagcccccg ccggggcggt cctgctgggc cctaccagca atctcagcgg ttggagctgt atgcccaggc cacagaagcg ctgctgaaga ccggagctgc ttacccctgt ttctgctcac cccagcggct ggagctcctg aagaaggagg ccttgcggaa ccaccagacg ccccggtatg acaatcggtg caggaacatg agccaggagc aggtggccca gaagctggcc aaggacccca agcctgcgat ccgcttccgc ctggagcagg tggtgccagc cttccaggac ctggtgtatg gctggaatag gcatgaagtg gccagcgtgg agggagaccc agtcatcatg aagagcgacg gcttccccac ataccacctg gcctgcgtgg tggacgacca ccacatgggc atcagccacg tgctgcgagg ctctgagtgg ctcgtctcca ctgccaagca cctgctcctc taccaggccc tgggctggca gccaccccac ttcgcccacc tgcccctgct cctcaacagg gatggcagca agctctccaa gaggcaaggg gacgttttcc tggagcactt tgctgctgat ggcttcctgc ccgattcctt gttggacatc atcaccaact gtggctcagg ttttgcagag aaccaaatgg gcaggaccct gccggagctg atcacacagt tcaacctgac acaggtcacc tgtcactcag ccctgctgga cctggagaag ctcccagaat tcaacagact gcacctccag cggctggtga gcaatgagag ccagaggcgc cagctggtgg ggaagctgca ggtccttgtg gaggaggcct ttggttgcca gctgcaaaac agggatgtcc tcaacccagt ctacgtggag aggatcctcc tgctgagaca gggtcacatt tgccgcctgc aggacttggt gtccccagta tactcttacc tgtggactcg ccctgcagta ggtcgagcac agctggacgc catctcggag aaggtggatg tgattgccaa gcgtgtgctg gggcttctag aaagatctgg tatgagctta actcaggata tgctgaatgg agaactgaag aagctatcag aaggtttgga aggcaccaag tacagtaatg tgatgaaact ccttcggatg gccctcagtg gacagcaggt gaggcaggga cacgggttgg attgttccct ggagcccctc attgatcctt tgaacttaca tttcctggca ggcactgagc tcaatattga gtatacaaag gtgaatgaaa catga. It is sometimes possible for the material contained within the vial of "EARS2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.