Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DVL2 cdna clone

DVL2 cDNA Clone

Synonyms
DVL2; DVL2 cDNA Clone; DVL2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgggtagcagcactgggggcggtggggttggggagacgaaggtgatttaccacctggatgaggaagagactccctacctggtgaagatccctgtccccgccgagcgcatcaccctcggcgatttcaagagcgtcctgcagcggcccgcgggcgccaagtactttttcaagtctatggatcaggatttcggggtggtgaaggaagaaatttcagatgacaacgcccgcctcccctgcttcaacggaagggtggtatcctggctggtgtcctcagataatccccaacccgagatggcccctccagtccatgagcctcgggcagaactggcgcctccagccccacctttacctcctttgccacccgagaggaccagcggcattggggactcaaggcctccatccttccaccctaatgtgtccagcagccatgagaatctggagcctgagacagaaaccgagtcagtagtgtcactgaggcgggagcggcctcgcaggagagacagcagtgagcatggcgctgggggccacaggactggtggcccctcaaggctggagcgccacctggccggatacgagagctcctctaccctcatgaccagcgagctggagagtaccagcctgggggactcggacgaggaggacaccatgagcaggttcagcagctccacggagcagagcagtgcctcccgcctccttaagcgccaccggcggcgaaggaagcagaggccaccccgcctggagaggacgtcatccttcagcagcgtcacagattccacaatgtctctcaatatcatcacagtcacgctaaacatggagaagtacaacttcctgggtatctccattgttggccagagcaatgagcggggagacggaggcatctacattggctccatcatgaagggtggggctgtggcggccgacgggcgcattgagccaggggacatgcttttgcaggtgaatgacatgaactttgagaacatgagcaacgatgacgctgtgcgggtgctgagggacattgtgcacaagcctggccccattgtgctgactgtggccaagtgctgggatccctctcctcaggcctatttcactctcccccgaaatgagcccatccagccaattgaccctgctgcctgggtgtcccattccgcggctctgactggcaccttcccagcctatccaggttcctcctccatgagcaccattacatctggatcgtctttgcctgatggctgtgaaggccggggtctctccgtccatacggacatggcatcggtgaccaaggccatggcagctccagagtctggactggaagtccgggaccgcatgtggctcaagatcaccatccctaatgcctttctgggctcggatgtggttgactggctctaccatcacgtggagggctttcctgagcggcgggaggcccgcaagtatgccagcgggctgctcaaagcaggcctgatccgacacaccgtcaacaagatcaccttctctgagcagtgctattacgtcttcggagacctcagtggtggctgtgagagctacctagtcaacctgtctctcaatgacaacgatggctccagtggggcttcagaccaggataccctggctcctctgcctggggccaccccctggcccctgctgcccactttctcctaccaataccctgccccacacccctacagcccgcagcctccaccctaccatgagctttcatcttacacctatggtgggggcagtgccagcagccagcatagtgagggcagccggagcagtgggtcgacacggagtgatgggggggcagggcgcacggggaggcccgaggagcgggcccccgagtccaagtccggcagtggcagtgagtctgagccctccagccgagggggcagccttcggcggggtggggaagcaagtgggactagcgatgggggccctcctccatccagaggctcaactgggggtgcccctaatctccgagcccacccagggctccatccctatggaccgccccctggcatggccctcccctacaaccccatgatggtggtcatgatgcccccacctccacctccagtccctccagcagtgcagcctccgggggcccctccagtcagagacctgggctctgtgcccccagaactgacagccagccgccaaagcttccacatggccatgggcaatcccagcgagttctttgtggatgttatgtag
Sequence Length
2211
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
78,948 Da
NCBI Official Full Name
Homo sapiens dishevelled, dsh homolog 2 (Drosophila), mRNA
NCBI Official Synonym Full Names
dishevelled segment polarity protein 2
NCBI Official Symbol
DVL2
NCBI Protein Information
segment polarity protein dishevelled homolog DVL-2
UniProt Protein Name
Segment polarity protein dishevelled homolog DVL-2
UniProt Gene Name
DVL2
UniProt Synonym Gene Names
Dishevelled-2
UniProt Entry Name
DVL2_HUMAN

NCBI Description

This gene encodes a member of the dishevelled (dsh) protein family. The vertebrate dsh proteins have approximately 40% amino acid sequence similarity with Drosophila dsh. This gene encodes a 90-kD protein that undergoes posttranslational phosphorylation to form a 95-kD cytoplasmic protein, which may play a role in the signal transduction pathway mediated by multiple Wnt proteins. The mechanisms of dishevelled function in Wnt signaling are likely to be conserved among metazoans. [provided by RefSeq, Jul 2008]

Uniprot Description

DVL2: a protein in the WNT/planar cell polarity (PCP) signaling pathway. Dvl2-deficient mice indicate that Dvl2 is essential for normal cardiac morphogenesis, somite segmentation and neural tube closure. Transduces the Wnt signal by interacting with the cytoplasmic Axin complex. Dvl and Axin each contain a DIX domains, which mediate their dynamic polymerization. The Dvl-Axin interaction is essential for Wnt signaling. Interacts through its PDZ domain with the C-terminal regions of VANGL1 and VANGL2. Interacts with Dixin and Rac. There is functional redundancy between Dvl1 and Dvl2 in some phenotypes.

Protein type: Adaptor/scaffold; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 17p13.1

Cellular Component: clathrin-coated endocytic vesicle; cytoplasm; cytoplasmic vesicle; cytosol; nucleus

Molecular Function: frizzled binding; identical protein binding; protein binding

Biological Process: heart development; neural tube closure; positive regulation of JNK activity; positive regulation of protein amino acid phosphorylation; positive regulation of transcription factor activity; positive regulation of transcription, DNA-dependent; segment specification; transcription from RNA polymerase II promoter; Wnt receptor signaling pathway; Wnt receptor signaling pathway through beta-catenin; Wnt receptor signaling pathway, planar cell polarity pathway

Research Articles on DVL2

Similar Products

Product Notes

The DVL2 dvl2 (Catalog #AAA1273741) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgggta gcagcactgg gggcggtggg gttggggaga cgaaggtgat ttaccacctg gatgaggaag agactcccta cctggtgaag atccctgtcc ccgccgagcg catcaccctc ggcgatttca agagcgtcct gcagcggccc gcgggcgcca agtacttttt caagtctatg gatcaggatt tcggggtggt gaaggaagaa atttcagatg acaacgcccg cctcccctgc ttcaacggaa gggtggtatc ctggctggtg tcctcagata atccccaacc cgagatggcc cctccagtcc atgagcctcg ggcagaactg gcgcctccag ccccaccttt acctcctttg ccacccgaga ggaccagcgg cattggggac tcaaggcctc catccttcca ccctaatgtg tccagcagcc atgagaatct ggagcctgag acagaaaccg agtcagtagt gtcactgagg cgggagcggc ctcgcaggag agacagcagt gagcatggcg ctgggggcca caggactggt ggcccctcaa ggctggagcg ccacctggcc ggatacgaga gctcctctac cctcatgacc agcgagctgg agagtaccag cctgggggac tcggacgagg aggacaccat gagcaggttc agcagctcca cggagcagag cagtgcctcc cgcctcctta agcgccaccg gcggcgaagg aagcagaggc caccccgcct ggagaggacg tcatccttca gcagcgtcac agattccaca atgtctctca atatcatcac agtcacgcta aacatggaga agtacaactt cctgggtatc tccattgttg gccagagcaa tgagcgggga gacggaggca tctacattgg ctccatcatg aagggtgggg ctgtggcggc cgacgggcgc attgagccag gggacatgct tttgcaggtg aatgacatga actttgagaa catgagcaac gatgacgctg tgcgggtgct gagggacatt gtgcacaagc ctggccccat tgtgctgact gtggccaagt gctgggatcc ctctcctcag gcctatttca ctctcccccg aaatgagccc atccagccaa ttgaccctgc tgcctgggtg tcccattccg cggctctgac tggcaccttc ccagcctatc caggttcctc ctccatgagc accattacat ctggatcgtc tttgcctgat ggctgtgaag gccggggtct ctccgtccat acggacatgg catcggtgac caaggccatg gcagctccag agtctggact ggaagtccgg gaccgcatgt ggctcaagat caccatccct aatgcctttc tgggctcgga tgtggttgac tggctctacc atcacgtgga gggctttcct gagcggcggg aggcccgcaa gtatgccagc gggctgctca aagcaggcct gatccgacac accgtcaaca agatcacctt ctctgagcag tgctattacg tcttcggaga cctcagtggt ggctgtgaga gctacctagt caacctgtct ctcaatgaca acgatggctc cagtggggct tcagaccagg ataccctggc tcctctgcct ggggccaccc cctggcccct gctgcccact ttctcctacc aataccctgc cccacacccc tacagcccgc agcctccacc ctaccatgag ctttcatctt acacctatgg tgggggcagt gccagcagcc agcatagtga gggcagccgg agcagtgggt cgacacggag tgatgggggg gcagggcgca cggggaggcc cgaggagcgg gcccccgagt ccaagtccgg cagtggcagt gagtctgagc cctccagccg agggggcagc cttcggcggg gtggggaagc aagtgggact agcgatgggg gccctcctcc atccagaggc tcaactgggg gtgcccctaa tctccgagcc cacccagggc tccatcccta tggaccgccc cctggcatgg ccctccccta caaccccatg atggtggtca tgatgccccc acctccacct ccagtccctc cagcagtgca gcctccgggg gcccctccag tcagagacct gggctctgtg cccccagaac tgacagccag ccgccaaagc ttccacatgg ccatgggcaa tcccagcgag ttctttgtgg atgttatgta g. It is sometimes possible for the material contained within the vial of "DVL2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.