DUS3L cdna clone
DUS3L cDNA Clone
Gene Names
DUS3L; DUS3
Synonyms
DUS3L; DUS3L cDNA Clone; DUS3L cdna clone
Sequence
atggcggagggaacggcggaggctcctctagagaatggtggtggtggcgactcgggagccggagctttggaacgaggagtggcgcccattaagcgtcaatacctcaccaccaaggagcagtttcaccaattcctggaagccaaagggcaggagaagacttgccgggaaaccgagctggacatccgtggcaaactttacctggcccccctcaccacgtgtgggaacctgcccttccgacggatctgcaagcgcttcggggcggatgtgacatgtggagagatggccgtctgcaccaacctgctgcagggccagatgtccgagtgggccctactcaaacgccaccagtgtgaggacatctttggcgtccagctggagggcgccttccccgacaccatgaccaagtgtgccgagctgctgagccgcaccgtggaggtggactttgtggacatcaacgtcggctgccccatcgacctcgtgtacaagaagggtgggggctgtgccctcatgaatcgctccaccaagttccagcagatcgtccgtggcatgaaccaggtgctggatgtgccgctgactgtgaagatccgcacaggcgtccaggagcgtgtgaacctggcgcaccgcctgctgcccgagctgcgggactggggcgtggcactcgtcacgctccacggccgctctcgggagcagcgctacaccaagctagccgactggcagtacatcgaggagtgcgtgcaggccgccagccccatgcccctgttcggaaatggggacatcttgtcatttgaggatgccaaccgcgccatgcagactggtgtcaccgggatcatgattgcccgtggcgccctgctcaagccgtggctcttcacggagatcaaggagcagcggcactgggacatctcgtcgtccgagcgcctggacatcctgcgggacttcaccaactacggcctggagcactggggctcggacacgcagggcgtggagaagacccggcgctttctgctcgagtggctgtccttcctgtgccggtacgtgcccgtggggctgctggagcggctcccacagaggatcaacgagcggccgccctactacctgggccgcgactacctggagacgctgatggccagccagaaggcagccgactggatccgcatcagcgagatgctccttgggccagtgccccccagcttcgccttcttgccgaagcacaaggccaacgcgtacaagtag
Sequence Length
1227
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
46,106 Da
NCBI Official Full Name
Homo sapiens dihydrouridine synthase 3-like (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
dihydrouridine synthase 3 like
NCBI Official Symbol
DUS3L
NCBI Official Synonym Symbols
DUS3
NCBI Protein Information
tRNA-dihydrouridine(47) synthase [NAD(P)(+)]-like
UniProt Protein Name
tRNA-dihydrouridine(47) synthase [NAD(P)(+)]-like
UniProt Gene Name
DUS3L
UniProt Entry Name
DUS3L_HUMAN
Uniprot Description
DUS3L: Catalyzes the synthesis of dihydrouridine, a modified base found in the D-loop of most tRNAs. Belongs to the dus family. Dus3 subfamily. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: EC 1.-.-.-; Oxidoreductase; EC 1.3.1.-
Chromosomal Location of Human Ortholog: 19p13.3
Cellular Component: cytosol
Molecular Function: tRNA dihydrouridine synthase activity
Similar Products
Product Notes
The DUS3L dus3l (Catalog #AAA1271587) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggagg gaacggcgga ggctcctcta gagaatggtg gtggtggcga ctcgggagcc ggagctttgg aacgaggagt ggcgcccatt aagcgtcaat acctcaccac caaggagcag tttcaccaat tcctggaagc caaagggcag gagaagactt gccgggaaac cgagctggac atccgtggca aactttacct ggcccccctc accacgtgtg ggaacctgcc cttccgacgg atctgcaagc gcttcggggc ggatgtgaca tgtggagaga tggccgtctg caccaacctg ctgcagggcc agatgtccga gtgggcccta ctcaaacgcc accagtgtga ggacatcttt ggcgtccagc tggagggcgc cttccccgac accatgacca agtgtgccga gctgctgagc cgcaccgtgg aggtggactt tgtggacatc aacgtcggct gccccatcga cctcgtgtac aagaagggtg ggggctgtgc cctcatgaat cgctccacca agttccagca gatcgtccgt ggcatgaacc aggtgctgga tgtgccgctg actgtgaaga tccgcacagg cgtccaggag cgtgtgaacc tggcgcaccg cctgctgccc gagctgcggg actggggcgt ggcactcgtc acgctccacg gccgctctcg ggagcagcgc tacaccaagc tagccgactg gcagtacatc gaggagtgcg tgcaggccgc cagccccatg cccctgttcg gaaatgggga catcttgtca tttgaggatg ccaaccgcgc catgcagact ggtgtcaccg ggatcatgat tgcccgtggc gccctgctca agccgtggct cttcacggag atcaaggagc agcggcactg ggacatctcg tcgtccgagc gcctggacat cctgcgggac ttcaccaact acggcctgga gcactggggc tcggacacgc agggcgtgga gaagacccgg cgctttctgc tcgagtggct gtccttcctg tgccggtacg tgcccgtggg gctgctggag cggctcccac agaggatcaa cgagcggccg ccctactacc tgggccgcga ctacctggag acgctgatgg ccagccagaa ggcagccgac tggatccgca tcagcgagat gctccttggg ccagtgcccc ccagcttcgc cttcttgccg aagcacaagg ccaacgcgta caagtag. It is sometimes possible for the material contained within the vial of "DUS3L, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
