Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DUS1L cdna clone

DUS1L cDNA Clone

Gene Names
DUS1L; DUS1; PP3111
Synonyms
DUS1L; DUS1L cDNA Clone; DUS1L cdna clone
Ordering
For Research Use Only!
Sequence
atgatagccaagagaggtcactatggcgcctttctgcaggacgagtgggacctgctccaaagaatgattttgctggcccacgagaaactctctgttcctgtcacgtgcaaaatccgtgtcttcccggagattgacaagaccgtgaggtacgcccagatgctggagaaggccggctgccagttgctgacggtgcacggacgcaccaaggagcagaaggggcccctgtcgggtgcagcgtcctgggagcatatcaaggctgtgcggaaggctgtggccatccctgtgtttgctaacgggaacatccagtgcctgcaggacgtggagcgctgcctccgggacacgggtgtgcagggcgtcatgagcgcagagggcaacctgcacaaccccgccctgttcgagggccggagccctgccgtgtgggagctggccgaggagtatctggacatcgtgcgggagcacccctgccccctgtcctacgtccgggcccacctcttcaagctgtggcaccacacgctgcaggtgcaccaggagctgcgagaggagctggccaaggtgaagaccctggagggcatcgctgctgtgagccaggagctgaagctgcggtgtcaggaggagatatccaggcaggagggagcgaagcccaccggcgacttgcccttccactggatctgccagccctacatccggccggggcccagggaggggagcaaggagaaggcaggtgcgcgcagcaagcgggccctggaggaagaggagggtggcacggaggtcctgtccaagaacaagcaaaagaagcagctgaggaacccccacaagaccttcgacccctctctgaagccaaaatatgcaaagtgtgaccagtgtggaaacccaaagggcaacagatgtgtgttcagcctgtgccgcggctgctgcaagaagcgagcctccaaagagactgcagactgcccaggtcacggattgctttttaaaaccaaattggagaagtctctggcctggaaagaggcccagcctgagctgcaggagcctcagccagcagcacctggaacaccaggtggcttctccgaagtcatgggcagtgccctggcctga
Sequence Length
1092
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
53,230 Da
NCBI Official Full Name
Homo sapiens dihydrouridine synthase 1-like (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
dihydrouridine synthase 1 like
NCBI Official Symbol
DUS1L
NCBI Official Synonym Symbols
DUS1; PP3111
NCBI Protein Information
tRNA-dihydrouridine(16/17) synthase [NAD(P)(+)]-like
UniProt Protein Name
tRNA-dihydrouridine(16/17) synthase [NAD(P)(+)]-like
UniProt Gene Name
DUS1L
UniProt Entry Name
DUS1L_HUMAN

Uniprot Description

DUS1L: Catalyzes the synthesis of dihydrouridine, a modified base found in the D-loop of most tRNAs. Belongs to the dus family. Dus1 subfamily.

Protein type: EC 1.-.-.-; Oxidoreductase; EC 1.3.1.-

Chromosomal Location of Human Ortholog: 17q25.3

Cellular Component: cytosol

Molecular Function: tRNA dihydrouridine synthase activity

Similar Products

Product Notes

The DUS1L dus1l (Catalog #AAA1276757) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatagcca agagaggtca ctatggcgcc tttctgcagg acgagtggga cctgctccaa agaatgattt tgctggccca cgagaaactc tctgttcctg tcacgtgcaa aatccgtgtc ttcccggaga ttgacaagac cgtgaggtac gcccagatgc tggagaaggc cggctgccag ttgctgacgg tgcacggacg caccaaggag cagaaggggc ccctgtcggg tgcagcgtcc tgggagcata tcaaggctgt gcggaaggct gtggccatcc ctgtgtttgc taacgggaac atccagtgcc tgcaggacgt ggagcgctgc ctccgggaca cgggtgtgca gggcgtcatg agcgcagagg gcaacctgca caaccccgcc ctgttcgagg gccggagccc tgccgtgtgg gagctggccg aggagtatct ggacatcgtg cgggagcacc cctgccccct gtcctacgtc cgggcccacc tcttcaagct gtggcaccac acgctgcagg tgcaccagga gctgcgagag gagctggcca aggtgaagac cctggagggc atcgctgctg tgagccagga gctgaagctg cggtgtcagg aggagatatc caggcaggag ggagcgaagc ccaccggcga cttgcccttc cactggatct gccagcccta catccggccg gggcccaggg aggggagcaa ggagaaggca ggtgcgcgca gcaagcgggc cctggaggaa gaggagggtg gcacggaggt cctgtccaag aacaagcaaa agaagcagct gaggaacccc cacaagacct tcgacccctc tctgaagcca aaatatgcaa agtgtgacca gtgtggaaac ccaaagggca acagatgtgt gttcagcctg tgccgcggct gctgcaagaa gcgagcctcc aaagagactg cagactgccc aggtcacgga ttgcttttta aaaccaaatt ggagaagtct ctggcctgga aagaggccca gcctgagctg caggagcctc agccagcagc acctggaaca ccaggtggct tctccgaagt catgggcagt gccctggcct ga. It is sometimes possible for the material contained within the vial of "DUS1L, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.