Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DTYMK cdna clone

DTYMK cDNA Clone

Gene Names
DTYMK; CDC8; TMPK; TYMK; PP3731
Synonyms
DTYMK; DTYMK cDNA Clone; DTYMK cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcccggcgcggggctctcatagtgctggagggcgtggaccgcgccgggaagagcacgcagagccgcaagctggtggaagcgctgtgcgccgcgggccaccgcgccgaactgctccggttcccggaaagatcaactgaaatcggcaaacttctgagttcctacttgcaaaagaaaagtgacgtggaggatcactcggtgcacctgcttttttctgcaaatcgctgggaacaagtgccgttaattaaggaaaagttgagccagggcgtgaccctcgtcgtggacagatacgcattttctggtgtggccttcaccggtgccaaggagaatttttccctagactggtgtaaacagccagacgtgggccttcccaaacccgacctggtcctgttcctccagttacagctggcggatgctgccaagcggggagcgtttggccatgagcgctatgagaacggggctttccaggagcgggcgctccggtgtttccaccagctcatgaaagacacgactttgaactggaagatggtggatgcttccaaaagcatcgaagctgtccatgaggacatccgcgtgctctctgaggacgccatccgcactgccacagagaagccgctgggggagctatggaagtga
Sequence Length
639
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
21,064 Da
NCBI Official Full Name
Homo sapiens deoxythymidylate kinase (thymidylate kinase), mRNA
NCBI Official Synonym Full Names
deoxythymidylate kinase
NCBI Official Symbol
DTYMK
NCBI Official Synonym Symbols
CDC8; TMPK; TYMK; PP3731
NCBI Protein Information
thymidylate kinase
UniProt Protein Name
Thymidylate kinase
UniProt Gene Name
DTYMK
UniProt Synonym Gene Names
CDC8; TMPK; TYMK
UniProt Entry Name
KTHY_HUMAN

Uniprot Description

DTYMK: Catalyzes the conversion of dTMP to dTDP. Belongs to the thymidylate kinase family.

Protein type: Nucleotide Metabolism - pyrimidine; Mitochondrial; EC 2.7.4.9; Kinase, other

Chromosomal Location of Human Ortholog: 2q37.3

Cellular Component: cytosol; mitochondrion; nucleus

Molecular Function: nucleoside phosphate kinase activity; thymidylate kinase activity; uridylate kinase activity

Biological Process: cell cycle; cell proliferation; dTDP biosynthetic process; dTTP biosynthetic process; dUDP biosynthetic process; nucleobase, nucleoside and nucleotide interconversion

Research Articles on DTYMK

Similar Products

Product Notes

The DTYMK dtymk (Catalog #AAA1269734) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggccc ggcgcggggc tctcatagtg ctggagggcg tggaccgcgc cgggaagagc acgcagagcc gcaagctggt ggaagcgctg tgcgccgcgg gccaccgcgc cgaactgctc cggttcccgg aaagatcaac tgaaatcggc aaacttctga gttcctactt gcaaaagaaa agtgacgtgg aggatcactc ggtgcacctg cttttttctg caaatcgctg ggaacaagtg ccgttaatta aggaaaagtt gagccagggc gtgaccctcg tcgtggacag atacgcattt tctggtgtgg ccttcaccgg tgccaaggag aatttttccc tagactggtg taaacagcca gacgtgggcc ttcccaaacc cgacctggtc ctgttcctcc agttacagct ggcggatgct gccaagcggg gagcgtttgg ccatgagcgc tatgagaacg gggctttcca ggagcgggcg ctccggtgtt tccaccagct catgaaagac acgactttga actggaagat ggtggatgct tccaaaagca tcgaagctgt ccatgaggac atccgcgtgc tctctgagga cgccatccgc actgccacag agaagccgct gggggagcta tggaagtga. It is sometimes possible for the material contained within the vial of "DTYMK, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.