Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DTX3L cdna clone

DTX3L cDNA Clone

Gene Names
DTX3L; BBAP
Synonyms
DTX3L; DTX3L cDNA Clone; DTX3L cdna clone
Ordering
For Research Use Only!
Sequence
atggcctcccacctgcgcccgccgtccccgctcctcgtgcgggtgtacaagtccggcccccgagtacgaaggaagctggagagctacttccagagctctaagtcctcgggcggcggggagtgcacggtcagcacccaggaacacgaagccccgggcaccttccgggtggagttcagtgaaagggcagctaaggagagagtgttgaaaaaaggagagcaccaaatacttgttgacgaaaaacctgtgcccattttcctggtacccactgaaaattcaataaagaagaacacgagacctcaaatttcttcactgacacaatcacaagcagaaacaccgtctggtgatatgcatcaacatgaaggacatattcctaatgctgtggattcctgtctccaaaagatctttcttactgtaacagctgacctgaactgtaacctgttctccaaagagcagagggcatacataaccacactgtgccctagtatcagaaaaatggaaggtcacgatggaattgagaaggtgtgtggtgacttccaagacattgaaagaatacatcaatttttgagtgagcagttcctggaaagtgagcagaaacaacaattttccccttcaatgacagagaggaagccactcagtcagcaggagagggacagctgcatttctccttctgaaccagaaaccaaggcagaacaaaaaagcaactattttgaagttcccttgccttactttgaatactttaaatatatctgtcctgataaaatcaactcaatagagaaaagatttggtgtaaacattgaaatccaggagagttctccaaatatggtctgtttagatttcacctcaagtcgatcaggtgacctggaagcagctcgtgagtcttttgctagtgaatttcagaagaacacagaacctctgaagcaagaatgtgtctctttagcagacagtaagcaggcaaataaattcaaacaggaattgaatcaccagtttacaaagctccttataaaggagaaaggaggcgaattaactctccttgggacccaagatgacatttcagctgccaaacaaaaaatctctgaagcttttgtcaagatacctgtgaaactatttgctgccaattacatgatgaatgtaattgaggttgatagtgcccactataaacttttagaaactgaattactacaggagatatcagagatcgaaaaaaggtatgacatttgcagcaaggtttctgagaaaggtcagaaaacctgcattctgtttgaatccaaggacaggcaggtagatctatctgtgcatgcttatgcaagtttcatcgatgcctttcaacatgcctcatgtcagttgatgagagaagttcttttactgaagtctttgggcaaggagagaaagcacttacatcagaccaagtttgctgatgactttagaaaaagacatccaaatgtacactttgtgctaaatcaagagtcaatgactttgactggtttgccaaatcaccttgcaaaggcgaagcagtatgttctaaaaggaggaggaatgtcttcattggctggaaagaaattgaaagagggtcatgaaacaccgatggacattgatagcgatgattccaaagcagcttctccgccactcaagggctctgtgagttctgaggcctcagaactggacaagaaggaaaagggcatctgtgtcatctgtatggacaccattagtaacaaaaaagtgctaccaaagtgcaagcatgaattctgcgccccttgtatcaacaaagccatgtcatataagccaatctgtcccacatgccagacttcctatggtattcagaaaggaaatcagccagagggaagcatggttttcactgtttcaagagactcacttccaggttatgagtcctttggcaccattgtgattacttattctatgaaagcaggcatacaaacagaagaacacccaaacccaggaaagagataccctggaatacagcgaactgcatacttgcctgataataaggaaggaaggaaggttttgaaactgctttatagggcctttgaccaaaagctgatttttacagtggggtactctcgcgtattaggagtctcagatgtcatcacttggaatgatattcaccacaaaacatcccggtttggaggaccagaaatgtatggctatcctgatccttcttacctgaaacgtgtcaaagaggagctgaaagccaaaggaattgagtaa
Sequence Length
2223
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
25,792 Da
NCBI Official Full Name
Homo sapiens deltex 3-like (Drosophila), mRNA
NCBI Official Synonym Full Names
deltex E3 ubiquitin ligase 3L
NCBI Official Symbol
DTX3L
NCBI Official Synonym Symbols
BBAP
NCBI Protein Information
E3 ubiquitin-protein ligase DTX3L
UniProt Protein Name
E3 ubiquitin-protein ligase DTX3L
UniProt Gene Name
DTX3L
UniProt Synonym Gene Names
BBAP; Rhysin2
UniProt Entry Name
DTX3L_HUMAN

NCBI Description

DTX3L functions as an E3 ubiquitin ligase (Takeyama et al., 2003 [PubMed 12670957]).[supplied by OMIM, Nov 2009]

Uniprot Description

DTX3L: Ubiquitin ligase that mediates monoubiquitination of 'Lys-91' of histone H4 (H4K91ub1), in response to DNA damage. Protects cells exposed to DNA-damaging agents. The exact role of H4K91ub1 in DNA damage response is still unclear but it may function as a licensing signal for additional histone H4 post- translational modifications such as H4 'Lys-20' methylation (H4K20me). Involved in the recruitment of 53BP1/TP53BP1 to sites of DNA damage by mediating H4K91ub1 formation. Belongs to the Deltex family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Ubiquitin conjugating system; Ligase; EC 6.3.2.-; Ubiquitin ligase

Chromosomal Location of Human Ortholog: 3q21.1

Cellular Component: cytoplasm; cytosol; nucleoplasm; nucleus

Molecular Function: histone binding; protein binding; ubiquitin-protein ligase activity

Biological Process: double-strand break repair; histone monoubiquitination; protein polyubiquitination; response to DNA damage stimulus

Research Articles on DTX3L

Similar Products

Product Notes

The DTX3L dtx3l (Catalog #AAA1268204) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcctccc acctgcgccc gccgtccccg ctcctcgtgc gggtgtacaa gtccggcccc cgagtacgaa ggaagctgga gagctacttc cagagctcta agtcctcggg cggcggggag tgcacggtca gcacccagga acacgaagcc ccgggcacct tccgggtgga gttcagtgaa agggcagcta aggagagagt gttgaaaaaa ggagagcacc aaatacttgt tgacgaaaaa cctgtgccca ttttcctggt acccactgaa aattcaataa agaagaacac gagacctcaa atttcttcac tgacacaatc acaagcagaa acaccgtctg gtgatatgca tcaacatgaa ggacatattc ctaatgctgt ggattcctgt ctccaaaaga tctttcttac tgtaacagct gacctgaact gtaacctgtt ctccaaagag cagagggcat acataaccac actgtgccct agtatcagaa aaatggaagg tcacgatgga attgagaagg tgtgtggtga cttccaagac attgaaagaa tacatcaatt tttgagtgag cagttcctgg aaagtgagca gaaacaacaa ttttcccctt caatgacaga gaggaagcca ctcagtcagc aggagaggga cagctgcatt tctccttctg aaccagaaac caaggcagaa caaaaaagca actattttga agttcccttg ccttactttg aatactttaa atatatctgt cctgataaaa tcaactcaat agagaaaaga tttggtgtaa acattgaaat ccaggagagt tctccaaata tggtctgttt agatttcacc tcaagtcgat caggtgacct ggaagcagct cgtgagtctt ttgctagtga atttcagaag aacacagaac ctctgaagca agaatgtgtc tctttagcag acagtaagca ggcaaataaa ttcaaacagg aattgaatca ccagtttaca aagctcctta taaaggagaa aggaggcgaa ttaactctcc ttgggaccca agatgacatt tcagctgcca aacaaaaaat ctctgaagct tttgtcaaga tacctgtgaa actatttgct gccaattaca tgatgaatgt aattgaggtt gatagtgccc actataaact tttagaaact gaattactac aggagatatc agagatcgaa aaaaggtatg acatttgcag caaggtttct gagaaaggtc agaaaacctg cattctgttt gaatccaagg acaggcaggt agatctatct gtgcatgctt atgcaagttt catcgatgcc tttcaacatg cctcatgtca gttgatgaga gaagttcttt tactgaagtc tttgggcaag gagagaaagc acttacatca gaccaagttt gctgatgact ttagaaaaag acatccaaat gtacactttg tgctaaatca agagtcaatg actttgactg gtttgccaaa tcaccttgca aaggcgaagc agtatgttct aaaaggagga ggaatgtctt cattggctgg aaagaaattg aaagagggtc atgaaacacc gatggacatt gatagcgatg attccaaagc agcttctccg ccactcaagg gctctgtgag ttctgaggcc tcagaactgg acaagaagga aaagggcatc tgtgtcatct gtatggacac cattagtaac aaaaaagtgc taccaaagtg caagcatgaa ttctgcgccc cttgtatcaa caaagccatg tcatataagc caatctgtcc cacatgccag acttcctatg gtattcagaa aggaaatcag ccagagggaa gcatggtttt cactgtttca agagactcac ttccaggtta tgagtccttt ggcaccattg tgattactta ttctatgaaa gcaggcatac aaacagaaga acacccaaac ccaggaaaga gataccctgg aatacagcga actgcatact tgcctgataa taaggaagga aggaaggttt tgaaactgct ttatagggcc tttgaccaaa agctgatttt tacagtgggg tactctcgcg tattaggagt ctcagatgtc atcacttgga atgatattca ccacaaaaca tcccggtttg gaggaccaga aatgtatggc tatcctgatc cttcttacct gaaacgtgtc aaagaggagc tgaaagccaa aggaattgag taa. It is sometimes possible for the material contained within the vial of "DTX3L, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.