Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DSE cdna clone

DSE cDNA Clone

Gene Names
DSE; DSEP; DSEPI; SART2; EDSMC2; SART-2; DS-epi1
Synonyms
DSE; DSE cDNA Clone; DSE cdna clone
Ordering
For Research Use Only!
Sequence
atgaggactcacacacggggggctcccagtgtgtttttcatatatttgctttgctttgtgtcagcctacatcaccgacgagaacccagaagttatgattcccttcaccaatgccaactacgacagccatcccatgctgtacttctccagggcagaagtggcggagctgcagctcagggctgccagctcgcacgagcacattgcagcccgcctcacggaggctgtgcacacgatgctgtccagccccttggaatacctccctccctgggatcccaaggactacagtgcccgctggaatgaaatttttggaaacaacttgggtgccttggcaatgttctgtgtgctgtatcctgagaacattgaagcccgagacatggccaaagactacatggagaggatggcagcgcagcctagttggttggtgaaagatgctccttgggatgaggtcccgcttgctcactccctggttggttttgccactgcttatgacttcttgtacaactacctgagcaagacacaacaggagaagtttcttgaagtgattgccaatgcctcagggtatatgtatgaaacttcatacaggagaggatggggatttcaatacctgcacaatcatcagcccaccaactgtatggctttgctcacgggaagcctagtcctgatgaatcaaggatatcttcaagaagcctacttatggaccaaacaagttctgaccatcatggagaaatctctggtcttgctcagggaggtgacggatggctccctctatgaaggagttgcgtatggcagctacaccactagatcactcttccaatacatgtttctcgtccagaggcacttcaacatcaaccactttggccatccgtggcttaaacaacactttgcatttatgtatagaaccatcctgccagggtttcaaaggactgtggctattgcggactcaaattacaactggttttatggtccagaaagccaattagtgttccttgataaatttgtcatgcgtaatggcagtggtaactggctagctgaccaaatcagaaggaaccgtgtggtggaaggtccaggaacaccatccaaagggcagcgctggtgcactctgcacacagaatttctctggtatgatggcagcttgaaatcggttcctcctccagactttggcacccctacactgcattattttgaagactggggtgtcgtgacttatggaagtgcactacctgcagaaatcaatagatctttcctttccttcaagtctggaaaactggggggacgtgcaatatatgacattgtccacagaaacaaatacaaagattggatcaaaggatggagaaattttaatgcagggcatgaacatcctgatcaaaactcatttacttttgctcccaatggtgtgcctttcattactgaggctctgtacgggccaaagtacaccttcttcaacaatgttttgatgttttccccagctgtgtcaaagagctgcttttctccctgggtgggtcaggtcacagaagactgctcatcaaaatggtctaaatacaagcatgacctggcagctagttgtcaggggagggtggttgcagcagaggagaaaaatggggtggttttcatccgaggagaaggtgtgggagcttataacccccagctcaacctgaagaatgttcagaggaatctcatcctcctacatccacagctgcttctccttgtagaccaaatacacctgggagaggagagtcccttggagacagcagcgagcttcttccataatgtggatgttccttttgaggagactgtggtagatggtgtccatggggctttcatcaggcagagagatggtctctataaaatgtactggatggacgatactggctacagcgagaaagcaacctttgcctcagtgacatatcctcggggctatccctacaacgggacaaactatgtgaatgtcaccatgcacctccgaagtcccatcaccagggcagcttacctcttcatagggccatctatagatgttcagagcttcactgtccacggagactctcagcaactggatgtgttcatagccaccagcaaacatgcctacgccacatacctgtggacaggtgaggccacaggacagtctgcctttgcacaggtcattgctgatcgtcacaaaattctgtttgaccggaattcagccatcaagagcagcattgtccctgaggtgaaggactatgctgctattgtggaacagaacttgcagcattttaaaccagtgtttcagctgctggagaagcagatactgtcccgagtccggaacacagctagctttaggaagactgctgaacgcctgctgagattttcagataagagacagactgaggaggccattgacaggatttttgccatatcacagcaacagcagcagcaaagcaagtcaaagaaaaaccgaagggcaggcaaacgctataaatttgtggatgctgtccctgatatttttgcacagattgaagtcaatgagaaaaagattagacagaaagctcagattttggcacagaaagaactacccatagatgaagatgaagaaatgaaagaccttttagattttgcagatgtaacatacgagaaacataaaaatgggggcttgattaaaggccggtttggacaggcacggatggtgacaactacacacagcagggccccatcactgtctgcttcctataccaggttgttcctgattctgaacattgctattttctttgtcatgttggcaatgcaactgacttatttccagagggcccagagcctacatggccaaagatgtctttatgcagttcttctcatagatagctgtattttattatggttgtactcttcttgttcccaatcacagtgttag
Sequence Length
2877
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
109,773 Da
NCBI Official Full Name
Homo sapiens dermatan sulfate epimerase, mRNA
NCBI Official Synonym Full Names
dermatan sulfate epimerase
NCBI Official Symbol
DSE
NCBI Official Synonym Symbols
DSEP; DSEPI; SART2; EDSMC2; SART-2; DS-epi1
NCBI Protein Information
dermatan-sulfate epimerase
UniProt Protein Name
Dermatan-sulfate epimerase
UniProt Gene Name
DSE
UniProt Synonym Gene Names
SART2; DS epimerase; SART-2
UniProt Entry Name
DSE_HUMAN

NCBI Description

The protein encoded by this gene is a tumor-rejection antigen. It is localized to the endoplasmic reticulum and functions to convert D-glucuronic acid to L-iduronic acid during the biosynthesis of dermatan sulfate. This antigen possesses tumor epitopes capable of inducing HLA-A24-restricted and tumor-specific cytotoxic T lymphocytes in cancer patients and may be useful for specific immunotherapy. Mutations in this gene cause inmusculocontractural Ehlers-Danlos syndrome. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 9, and a paralogous gene exists on chromosome 18. [provided by RefSeq, Apr 2016]

Uniprot Description

SART2: Converts D-glucuronic acid to L-iduronic acid (IdoUA) residues. Belongs to the dermatan-sulfate isomerase family.

Protein type: Membrane protein, integral; Endoplasmic reticulum; Isomerase; Membrane protein, multi-pass; EC 5.1.3.19; Glycan Metabolism - chondroitin sulfate biosynthesis

Chromosomal Location of Human Ortholog: 6q22

Cellular Component: endoplasmic reticulum; Golgi apparatus; Golgi membrane

Molecular Function: chondroitin-glucuronate 5-epimerase activity

Biological Process: dermatan sulfate biosynthetic process

Disease: Ehlers-danlos Syndrome, Musculocontractural Type 2

Research Articles on DSE

Similar Products

Product Notes

The DSE dse (Catalog #AAA1265822) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaggactc acacacgggg ggctcccagt gtgtttttca tatatttgct ttgctttgtg tcagcctaca tcaccgacga gaacccagaa gttatgattc ccttcaccaa tgccaactac gacagccatc ccatgctgta cttctccagg gcagaagtgg cggagctgca gctcagggct gccagctcgc acgagcacat tgcagcccgc ctcacggagg ctgtgcacac gatgctgtcc agccccttgg aatacctccc tccctgggat cccaaggact acagtgcccg ctggaatgaa atttttggaa acaacttggg tgccttggca atgttctgtg tgctgtatcc tgagaacatt gaagcccgag acatggccaa agactacatg gagaggatgg cagcgcagcc tagttggttg gtgaaagatg ctccttggga tgaggtcccg cttgctcact ccctggttgg ttttgccact gcttatgact tcttgtacaa ctacctgagc aagacacaac aggagaagtt tcttgaagtg attgccaatg cctcagggta tatgtatgaa acttcataca ggagaggatg gggatttcaa tacctgcaca atcatcagcc caccaactgt atggctttgc tcacgggaag cctagtcctg atgaatcaag gatatcttca agaagcctac ttatggacca aacaagttct gaccatcatg gagaaatctc tggtcttgct cagggaggtg acggatggct ccctctatga aggagttgcg tatggcagct acaccactag atcactcttc caatacatgt ttctcgtcca gaggcacttc aacatcaacc actttggcca tccgtggctt aaacaacact ttgcatttat gtatagaacc atcctgccag ggtttcaaag gactgtggct attgcggact caaattacaa ctggttttat ggtccagaaa gccaattagt gttccttgat aaatttgtca tgcgtaatgg cagtggtaac tggctagctg accaaatcag aaggaaccgt gtggtggaag gtccaggaac accatccaaa gggcagcgct ggtgcactct gcacacagaa tttctctggt atgatggcag cttgaaatcg gttcctcctc cagactttgg cacccctaca ctgcattatt ttgaagactg gggtgtcgtg acttatggaa gtgcactacc tgcagaaatc aatagatctt tcctttcctt caagtctgga aaactggggg gacgtgcaat atatgacatt gtccacagaa acaaatacaa agattggatc aaaggatgga gaaattttaa tgcagggcat gaacatcctg atcaaaactc atttactttt gctcccaatg gtgtgccttt cattactgag gctctgtacg ggccaaagta caccttcttc aacaatgttt tgatgttttc cccagctgtg tcaaagagct gcttttctcc ctgggtgggt caggtcacag aagactgctc atcaaaatgg tctaaataca agcatgacct ggcagctagt tgtcagggga gggtggttgc agcagaggag aaaaatgggg tggttttcat ccgaggagaa ggtgtgggag cttataaccc ccagctcaac ctgaagaatg ttcagaggaa tctcatcctc ctacatccac agctgcttct ccttgtagac caaatacacc tgggagagga gagtcccttg gagacagcag cgagcttctt ccataatgtg gatgttcctt ttgaggagac tgtggtagat ggtgtccatg gggctttcat caggcagaga gatggtctct ataaaatgta ctggatggac gatactggct acagcgagaa agcaaccttt gcctcagtga catatcctcg gggctatccc tacaacggga caaactatgt gaatgtcacc atgcacctcc gaagtcccat caccagggca gcttacctct tcatagggcc atctatagat gttcagagct tcactgtcca cggagactct cagcaactgg atgtgttcat agccaccagc aaacatgcct acgccacata cctgtggaca ggtgaggcca caggacagtc tgcctttgca caggtcattg ctgatcgtca caaaattctg tttgaccgga attcagccat caagagcagc attgtccctg aggtgaagga ctatgctgct attgtggaac agaacttgca gcattttaaa ccagtgtttc agctgctgga gaagcagata ctgtcccgag tccggaacac agctagcttt aggaagactg ctgaacgcct gctgagattt tcagataaga gacagactga ggaggccatt gacaggattt ttgccatatc acagcaacag cagcagcaaa gcaagtcaaa gaaaaaccga agggcaggca aacgctataa atttgtggat gctgtccctg atatttttgc acagattgaa gtcaatgaga aaaagattag acagaaagct cagattttgg cacagaaaga actacccata gatgaagatg aagaaatgaa agacctttta gattttgcag atgtaacata cgagaaacat aaaaatgggg gcttgattaa aggccggttt ggacaggcac ggatggtgac aactacacac agcagggccc catcactgtc tgcttcctat accaggttgt tcctgattct gaacattgct attttctttg tcatgttggc aatgcaactg acttatttcc agagggccca gagcctacat ggccaaagat gtctttatgc agttcttctc atagatagct gtattttatt atggttgtac tcttcttgtt cccaatcaca gtgttag. It is sometimes possible for the material contained within the vial of "DSE, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.