DPYSL5 cdna clone

DPYSL5 cDNA Clone

Gene Names

DPYSL5; CRAM; CRMP5; Ulip6; CRMP-5

Synonyms

DPYSL5; DPYSL5 cDNA Clone; DPYSL5 cdna clone

Ordering
Cat. Num. AAA1270598 For Research Use Only!

Sequence

atgcttgccaactcagccagcgtgaggatcctcatcaagggaggcaaggtggtgaacgatgactgcacccacgaggctgacgtctacatcgagaatggcatcatccagcaggtgggccgcgagctcatgatccctggcggggccaaggtgattgatgccacaggaaaactggtgatccctggtggcatcgacaccagcacccacttccaccagaccttcatgaatgccacgtgcgtggacgacttctaccatgggaccaaggcagcactcgtcggaggcaccaccatgatcatcggccacgtcctgcccgacaaggagacctcccttgtggacgcttatgagaagtgccgaggtctggccgaccccaaggtctgctgtgattacgccctccacgtggggatcacctggtgggcacccaaggtgaaagcagaaatggagacactggtgagggagaagggtgtcaactcgttccagatgttcatgacctacaaggacctgtacatgcttcgagacagtgagctgtaccaagtgttgcacgcttgcaaggacattggggcaatcgcccgcgtccatgctgaaaatggggagcttgtggccgagggtgctaaggaggcactggatttggggatcacaggcccagaaggaatcgagatcagccgtccagaggagctggaagctgaagccactcatcgtgttatcaccattgcaaacaggactcactgtccaatctacctggtcaacgtgtccagtatctcggctggtgacgttatcgcagctgctaagatgcaagggaaggttgtgctggcggagaccaccactgcacatgccacgctgacaggcttacactactaccaccaggactggtcccacgcggctgcctatgtcacggtgcctcccctgagactggacaccaacacctcaacctacctcatgagcctgctggccaatgacactctgaacatcgtggcatcagatcaccggcctttcaccacaaagcagaaagctatgggcaaggaagacttcaccaagatcccacatggagtgagtggcgtgcaggaccgcatgagcgtcatctgggagagaggagtggttggaggaaagatggatgagaaccgttttgtggccgttaccagttccaacgcagctaagcttctgaacctgtatccccgcaagggccgcattattcccggagccgatgctgatgtggtggtgtgggacccagaagccacaaagaccatctcagccagcacgcaggtccagggaggagacttcaacctgtatgagaacatgcgctgccacggcgtgccactggtcaccatcagccgggggcgcgtcgtgtatgagaacggcgtcttcatgtgcgccgagggcaccggcaagttctgtcccctgaggtccttcccagacactgtctacaagaagctggtccagagagagaagactttaaaggttagaggagtggaccgcactccctacctgggggatgtcgctgttgtcgtgcaccctgggaaaaaagagatgggaaccccactcgcagacactcctacccggcccgtcacccggcatgggggcatgagggaccttcacgaatccagcttcagcctctctggctctcagatcgatgaccatgttccaaagcgagcttcagctcggatcctcgctcctcccggaggcaggtcgagtggcatttggtaa

Sequence Length

1695

Vector

pENTR223.1 or pUC

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

33877272

NCBI GeneID

56896

Molecular Weight

61,421 Da

NCBI Official Full Name

Homo sapiens dihydropyrimidinase-like 5, mRNA

NCBI Official Synonym Full Names

dihydropyrimidinase like 5

NCBI Official Symbol

DPYSL5

NCBI Official Synonym Symbols

CRAM; CRMP5; Ulip6; CRMP-5

NCBI Protein Information

dihydropyrimidinase-related protein 5

UniProt Protein Name

Dihydropyrimidinase-related protein 5

Protein Family

Dihydropyrimidinase-related protein

UniProt Gene Name

DPYSL5

UniProt Synonym Gene Names

CRMP5; ULIP6; DRP-5; CRAM; CRMP-5; ULIP-6

UniProt Entry Name

DPYL5_HUMAN

NCBI Description

This gene encodes a member of the CRMP (collapsing response mediator protein) family thought to be involved in neural development. Antibodies to the encoded protein were found in some patients with neurologic symptoms who had paraneoplastic syndrome. A pseudogene of this gene is found on chromosome 11. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Dec 2011]

Uniprot Description

CRMP-5: May have a function in neuronal differentiation and/or axon growth. Belongs to the DHOase family. Hydantoinase/dihydropyrimidinase subfamily.

Chromosomal Location of Human Ortholog: 2p23.3

Cellular Component: cytosol

Molecular Function: protein binding

Biological Process: nervous system development; signal transduction

Research Articles on DPYSL5

1. Our findings suggest that CRMP5 serves as a major mediator of Notch signaling and Akt activation by controlling the degradation of the Notch receptor, with implications for defining a biomarker signature in glioblastoma

Similar Products

Product Notes

The DPYSL5 dpysl5 (Catalog #AAA1270598) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcttgcca actcagccag cgtgaggatc ctcatcaagg gaggcaaggt ggtgaacgat gactgcaccc acgaggctga cgtctacatc gagaatggca tcatccagca ggtgggccgc gagctcatga tccctggcgg ggccaaggtg attgatgcca caggaaaact ggtgatccct ggtggcatcg acaccagcac ccacttccac cagaccttca tgaatgccac gtgcgtggac gacttctacc atgggaccaa ggcagcactc gtcggaggca ccaccatgat catcggccac gtcctgcccg acaaggagac ctcccttgtg gacgcttatg agaagtgccg aggtctggcc gaccccaagg tctgctgtga ttacgccctc cacgtgggga tcacctggtg ggcacccaag gtgaaagcag aaatggagac actggtgagg gagaagggtg tcaactcgtt ccagatgttc atgacctaca aggacctgta catgcttcga gacagtgagc tgtaccaagt gttgcacgct tgcaaggaca ttggggcaat cgcccgcgtc catgctgaaa atggggagct tgtggccgag ggtgctaagg aggcactgga tttggggatc acaggcccag aaggaatcga gatcagccgt ccagaggagc tggaagctga agccactcat cgtgttatca ccattgcaaa caggactcac tgtccaatct acctggtcaa cgtgtccagt atctcggctg gtgacgttat cgcagctgct aagatgcaag ggaaggttgt gctggcggag accaccactg cacatgccac gctgacaggc ttacactact accaccagga ctggtcccac gcggctgcct atgtcacggt gcctcccctg agactggaca ccaacacctc aacctacctc atgagcctgc tggccaatga cactctgaac atcgtggcat cagatcaccg gcctttcacc acaaagcaga aagctatggg caaggaagac ttcaccaaga tcccacatgg agtgagtggc gtgcaggacc gcatgagcgt catctgggag agaggagtgg ttggaggaaa gatggatgag aaccgttttg tggccgttac cagttccaac gcagctaagc ttctgaacct gtatccccgc aagggccgca ttattcccgg agccgatgct gatgtggtgg tgtgggaccc agaagccaca aagaccatct cagccagcac gcaggtccag ggaggagact tcaacctgta tgagaacatg cgctgccacg gcgtgccact ggtcaccatc agccgggggc gcgtcgtgta tgagaacggc gtcttcatgt gcgccgaggg caccggcaag ttctgtcccc tgaggtcctt cccagacact gtctacaaga agctggtcca gagagagaag actttaaagg ttagaggagt ggaccgcact ccctacctgg gggatgtcgc tgttgtcgtg caccctggga aaaaagagat gggaacccca ctcgcagaca ctcctacccg gcccgtcacc cggcatgggg gcatgaggga ccttcacgaa tccagcttca gcctctctgg ctctcagatc gatgaccatg ttccaaagcg agcttcagct cggatcctcg ctcctcccgg aggcaggtcg agtggcattt ggtaa. It is sometimes possible for the material contained within the vial of "DPYSL5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

DPYSL5 cdna clone