Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DPYD cdna clone

DPYD cDNA Clone

Gene Names
DPYD; DHP; DPD; DHPDHASE
Synonyms
DPYD; DPYD cDNA Clone; DPYD cdna clone
Ordering
For Research Use Only!
Sequence
atggcccctgtgctcagtaaggactcggcggacatcgagagtatcctggctttaaatcctcgaacacaaactcatgcaactctgtgttccacttcggccaagaaattagacaagaaacattggaaaagaaatcctgataagaactgctttaattgtgagaagctggagaataattttgatgacatcaagcacacgactcttggtgagcgaggagctctccgagaagcaatgagatgcctgaaatgtgcagatgccccgtgtcagaagagctgtccaactaatcttgatattaaatcattcatcacaagtattgcaaacaagaactattatggagctgctaagatgatattttctgacaacccacttggtctgacttgtggaatggtatgtccaacctctgatctttgtgtaggtggatgcaatttatatgccactgaagagggacccattaatattggtggattgcagcaatttgctactgagactttgatcctggctttctctttaatgaatcatttgtaa
Sequence Length
522
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
18,936 Da
NCBI Official Full Name
Homo sapiens dihydropyrimidine dehydrogenase, mRNA
NCBI Official Synonym Full Names
dihydropyrimidine dehydrogenase
NCBI Official Symbol
DPYD
NCBI Official Synonym Symbols
DHP; DPD; DHPDHASE
NCBI Protein Information
dihydropyrimidine dehydrogenase [NADP(+)]
UniProt Protein Name
Dihydropyrimidine dehydrogenase [NADP(+)]
UniProt Gene Name
DPYD
UniProt Synonym Gene Names
DHPDHase; DPD
UniProt Entry Name
DPYD_HUMAN

NCBI Description

The protein encoded by this gene is a pyrimidine catabolic enzyme and the initial and rate-limiting factor in the pathway of uracil and thymidine catabolism. Mutations in this gene result in dihydropyrimidine dehydrogenase deficiency, an error in pyrimidine metabolism associated with thymine-uraciluria and an increased risk of toxicity in cancer patients receiving 5-fluorouracil chemotherapy. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]

Uniprot Description

DPYD: Involved in pyrimidine base degradation. Catalyzes the reduction of uracil and thymine. Also involved the degradation of the chemotherapeutic drug 5-fluorouracil. Homodimer. Found in most tissues with greatest activity found in liver and peripheral blood mononuclear cells. Belongs to the dihydropyrimidine dehydrogenase family.

Protein type: Xenobiotic Metabolism - drug metabolism - other enzymes; Oxidoreductase; Nucleotide Metabolism - pyrimidine; EC 1.3.1.2; Other Amino Acids Metabolism - beta-alanine; Cofactor and Vitamin Metabolism - pantothenate and CoA biosynthesis

Chromosomal Location of Human Ortholog: 1p22

Cellular Component: cytoplasm; cytosol

Molecular Function: dihydropyrimidine dehydrogenase (NADP+) activity; FAD binding; NADP binding; protein binding; protein homodimerization activity

Biological Process: purine base catabolic process; pyrimidine base catabolic process; pyrimidine nucleoside catabolic process; thymidine catabolic process; thymine catabolic process; uracil catabolic process

Disease: Dihydropyrimidine Dehydrogenase Deficiency

Research Articles on DPYD

Similar Products

Product Notes

The DPYD dpyd (Catalog #AAA1270634) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcccctg tgctcagtaa ggactcggcg gacatcgaga gtatcctggc tttaaatcct cgaacacaaa ctcatgcaac tctgtgttcc acttcggcca agaaattaga caagaaacat tggaaaagaa atcctgataa gaactgcttt aattgtgaga agctggagaa taattttgat gacatcaagc acacgactct tggtgagcga ggagctctcc gagaagcaat gagatgcctg aaatgtgcag atgccccgtg tcagaagagc tgtccaacta atcttgatat taaatcattc atcacaagta ttgcaaacaa gaactattat ggagctgcta agatgatatt ttctgacaac ccacttggtc tgacttgtgg aatggtatgt ccaacctctg atctttgtgt aggtggatgc aatttatatg ccactgaaga gggacccatt aatattggtg gattgcagca atttgctact gagactttga tcctggcttt ctctttaatg aatcatttgt aa. It is sometimes possible for the material contained within the vial of "DPYD, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.