DOCK5 cdna clone
DOCK5 cDNA Clone
Synonyms
DOCK5; DOCK5 cDNA Clone; DOCK5 cdna clone
Sequence
atggcccgctggatcccgaccaagaggcagaagtacggggttgcgatctataactacaatgcttctcaagatgtggagctctccttgcagatcggtgacacagttcacatcctggagatgtacgagggttggtacagaggatataccctccaaaataaatctaaaaagggcattttccctgaaacatatatccatttgaaagaggcaactgtggaagacctggggcagcatgaaaccgtgattcctggcgagctccccctggtgcaggagctcacgtccactctgcgagaatgggctgtcatctggcgaaagctctacgtgaacaacaagctcaccctcttccgccagctgcagcagatgacgtacagcctgatcgagtggcggtcccagatcctgtctgggacgctccccaaggatgaactggcagagctcaagaagaaagtcacagccaaaattgatcatgggaacagaatgctggggttagatctggtggtgcgagatgacaatgggaacatcctagaccctgacgaaaccagcaccattgccctcttcaaggcccatgaggtggcctccaaaaggattgaggaaaagatccaagaagagaagtcaatcctgcagaacctcgatttgcggggccagtccatcttcagtaccatccacacctatggcctctatgtgaacttcaagaactttgtctgcaacatcggggaagatgcagagttgtttatggccctctacgacccagaccagtccacttttatcagtgagaactatctaattcgttggggcagtaacgggatgcccaaggaaatagagaagctcaataacctccaagcagtgtttacagaccttagcagcatggacctcatccggccccgcgtcagccttgtatgccagattgtccgcgtgggccatatggagctgaaggaaggcaagaagcacacctgtggactccgaagaccttttggagtggcagtgatggatattactgatatcatacatgggaaggtggatgatgaagaaaagcagcattttattccctttcagcagtaa
Sequence Length
1053
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
40,421 Da
NCBI Official Full Name
Homo sapiens dedicator of cytokinesis 5, mRNA
NCBI Official Synonym Full Names
dedicator of cytokinesis 5
NCBI Official Symbol
DOCK5
NCBI Protein Information
dedicator of cytokinesis protein 5
UniProt Protein Name
Dedicator of cytokinesis protein 5
Protein Family
UniProt Gene Name
DOCK5
UniProt Entry Name
DOCK5_HUMAN
Uniprot Description
DOCK5: Guanine nucleotide exchange factor (GEF) for Rho and Rac. GEF proteins activate small GTPases by exchanging bound GDP for free GTP. Belongs to the DOCK family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Motility/polarity/chemotaxis; GAPs; GAPs, Rac/Rho
Chromosomal Location of Human Ortholog: 8p21.2
Cellular Component: cytoplasm; plasma membrane
Molecular Function: guanyl-nucleotide exchange factor activity; protein binding
Research Articles on DOCK5
Similar Products
Product Notes
The DOCK5 dock5 (Catalog #AAA1277805) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcccgct ggatcccgac caagaggcag aagtacgggg ttgcgatcta taactacaat gcttctcaag atgtggagct ctccttgcag atcggtgaca cagttcacat cctggagatg tacgagggtt ggtacagagg atataccctc caaaataaat ctaaaaaggg cattttccct gaaacatata tccatttgaa agaggcaact gtggaagacc tggggcagca tgaaaccgtg attcctggcg agctccccct ggtgcaggag ctcacgtcca ctctgcgaga atgggctgtc atctggcgaa agctctacgt gaacaacaag ctcaccctct tccgccagct gcagcagatg acgtacagcc tgatcgagtg gcggtcccag atcctgtctg ggacgctccc caaggatgaa ctggcagagc tcaagaagaa agtcacagcc aaaattgatc atgggaacag aatgctgggg ttagatctgg tggtgcgaga tgacaatggg aacatcctag accctgacga aaccagcacc attgccctct tcaaggccca tgaggtggcc tccaaaagga ttgaggaaaa gatccaagaa gagaagtcaa tcctgcagaa cctcgatttg cggggccagt ccatcttcag taccatccac acctatggcc tctatgtgaa cttcaagaac tttgtctgca acatcgggga agatgcagag ttgtttatgg ccctctacga cccagaccag tccactttta tcagtgagaa ctatctaatt cgttggggca gtaacgggat gcccaaggaa atagagaagc tcaataacct ccaagcagtg tttacagacc ttagcagcat ggacctcatc cggccccgcg tcagccttgt atgccagatt gtccgcgtgg gccatatgga gctgaaggaa ggcaagaagc acacctgtgg actccgaaga ccttttggag tggcagtgat ggatattact gatatcatac atgggaaggt ggatgatgaa gaaaagcagc attttattcc ctttcagcag taa. It is sometimes possible for the material contained within the vial of "DOCK5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
