Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DNTT cdna clone

DNTT cDNA Clone

Gene Names
DNTT; TDT
Synonyms
DNTT; DNTT cDNA Clone; DNTT cdna clone
Ordering
For Research Use Only!
Sequence
atggatccaccacgagcgtcccacttgagccctcggaagaagagaccccggcagacgggtgccttgatggcctcctctcctcaagacatcaaatttcaagatttggtcgtcttcattttggagaagaaaatgggaaccacccgcagagcgttcctcatggagctggcccgcaggaaagggttcagggttgaaaatgagctcagtgattctgtcacccacattgtagcagagaacaactcgggttcggatgttctggagtggcttcaagcacagaaagtacaagtcagctcacaaccagagctcctcgatgtctcctggctgatcgaatgcataggagcagggaaaccggtggaaatgacaggaaaacaccagcttgttgtgagaagagactattcagatagcaccaacccaggccccccgaagactccaccaattgctgtacaaaagatctcccagtatgcgtgtcagagaagaaccactttaaacaactgtaaccagatattcacggatgcctttgatatactggctgaaaactgtgagtttagagaaaatgaagactcctgtgtgacatttatgagagcagcttctgtattgaaatctctgccattcacaatcatcagtatgaaggacacagaaggaattccctgcctggggtccaaggtgaagggtatcatagaggagattattgaagatggagaaagttctgaagttaaagctgtgttaaatgatgaacgatatcaatccttcaaactctttacttctgtatttggagtggggctgaagacttctgagaagtggttcaggatgggtttcagaactctgagtaaagtaaggtcggacaaaagcctgaaatttacacgaatgcagaaagcaggatttctgtattatgaagaccttgtcagctgtgtgaccagggcagaagcagaggccgtcagtgtgctggttaaagaggctgtctgggcatttcttccggatgctttcgtcaccatgacaggagggttccggaggggtaagaagatggggcatgatgtagattttttaattaccagcccaggatcaacagaggatgaagagcaacttttacagaaagtgatgaacttatgggaaaagaagggattacttttatattatgaccttgtggagtcaacatttgaaaagctcaggttgcctagcaggaaggttgatgctttggatcattttcaaaagtgctttctgattttcaaattgcctcgtcaaagagtggacagtgaccagtccagctggcaggaaggaaagacctggaaggccatccgtgtggatttagttctgtgcccctacgagcgtcgtgcctttgccctgttgggatggactggctcccggcagtttgagagagacctccggcgctatgccacacatgagcggaagatgattctggataaccatgctttatatgacaagaccaagaggatattcctcaaagcagaaagtgaagaagaaatttttgcgcatctgggattggattatattgaaccgtgggaaagaaatgcctag
Sequence Length
1530
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
58,408 Da
NCBI Official Full Name
Homo sapiens deoxynucleotidyltransferase, terminal, mRNA
NCBI Official Synonym Full Names
DNA nucleotidylexotransferase
NCBI Official Symbol
DNTT
NCBI Official Synonym Symbols
TDT
NCBI Protein Information
DNA nucleotidylexotransferase
UniProt Protein Name
DNA nucleotidylexotransferase
UniProt Gene Name
DNTT
UniProt Synonym Gene Names
; Terminal transferase
UniProt Entry Name
TDT_HUMAN

NCBI Description

This gene is a member of the DNA polymerase type-X family and encodes a template-independent DNA polymerase that catalyzes the addition of deoxynucleotides to the 3'-hydroxyl terminus of oligonucleotide primers. In vivo, the encoded protein is expressed in a restricted population of normal and malignant pre-B and pre-T lymphocytes during early differentiation, where it generates antigen receptor diversity by synthesizing non-germ line elements (N-regions) at the junctions of rearranged Ig heavy chain and T cell receptor gene segments. Alternatively spliced transcript variants encoding different isoforms of this gene have been described. [provided by RefSeq, Jul 2008]

Uniprot Description

DNTT: Template-independent DNA polymerase which catalyzes the random addition of deoxynucleoside 5'-triphosphate to the 3'-end of a DNA initiator. One of the in vivo functions of this enzyme is the addition of nucleotides at the junction (N region) of rearranged Ig heavy chain and T-cell receptor gene segments during the maturation of B- and T-cells. Belongs to the DNA polymerase type-X family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 2.7.7.31; Transferase

Chromosomal Location of Human Ortholog: 10q23-q24

Cellular Component: cytoplasm; nucleoplasm; nucleus

Molecular Function: DNA nucleotidylexotransferase activity; protein binding

Biological Process: DNA metabolic process

Research Articles on DNTT

Similar Products

Product Notes

The DNTT dntt (Catalog #AAA1266982) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatccac cacgagcgtc ccacttgagc cctcggaaga agagaccccg gcagacgggt gccttgatgg cctcctctcc tcaagacatc aaatttcaag atttggtcgt cttcattttg gagaagaaaa tgggaaccac ccgcagagcg ttcctcatgg agctggcccg caggaaaggg ttcagggttg aaaatgagct cagtgattct gtcacccaca ttgtagcaga gaacaactcg ggttcggatg ttctggagtg gcttcaagca cagaaagtac aagtcagctc acaaccagag ctcctcgatg tctcctggct gatcgaatgc ataggagcag ggaaaccggt ggaaatgaca ggaaaacacc agcttgttgt gagaagagac tattcagata gcaccaaccc aggccccccg aagactccac caattgctgt acaaaagatc tcccagtatg cgtgtcagag aagaaccact ttaaacaact gtaaccagat attcacggat gcctttgata tactggctga aaactgtgag tttagagaaa atgaagactc ctgtgtgaca tttatgagag cagcttctgt attgaaatct ctgccattca caatcatcag tatgaaggac acagaaggaa ttccctgcct ggggtccaag gtgaagggta tcatagagga gattattgaa gatggagaaa gttctgaagt taaagctgtg ttaaatgatg aacgatatca atccttcaaa ctctttactt ctgtatttgg agtggggctg aagacttctg agaagtggtt caggatgggt ttcagaactc tgagtaaagt aaggtcggac aaaagcctga aatttacacg aatgcagaaa gcaggatttc tgtattatga agaccttgtc agctgtgtga ccagggcaga agcagaggcc gtcagtgtgc tggttaaaga ggctgtctgg gcatttcttc cggatgcttt cgtcaccatg acaggagggt tccggagggg taagaagatg gggcatgatg tagatttttt aattaccagc ccaggatcaa cagaggatga agagcaactt ttacagaaag tgatgaactt atgggaaaag aagggattac ttttatatta tgaccttgtg gagtcaacat ttgaaaagct caggttgcct agcaggaagg ttgatgcttt ggatcatttt caaaagtgct ttctgatttt caaattgcct cgtcaaagag tggacagtga ccagtccagc tggcaggaag gaaagacctg gaaggccatc cgtgtggatt tagttctgtg cccctacgag cgtcgtgcct ttgccctgtt gggatggact ggctcccggc agtttgagag agacctccgg cgctatgcca cacatgagcg gaagatgatt ctggataacc atgctttata tgacaagacc aagaggatat tcctcaaagc agaaagtgaa gaagaaattt ttgcgcatct gggattggat tatattgaac cgtgggaaag aaatgcctag. It is sometimes possible for the material contained within the vial of "DNTT, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.