Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DNM1L cdna clone

DNM1L cDNA Clone

Gene Names
DNM1L; DLP1; DRP1; DVLP; EMPF; EMPF1; DYMPLE; HDYNIV
Synonyms
DNM1L; DNM1L cDNA Clone; DNM1L cdna clone
Ordering
For Research Use Only!
Sequence
atggaggcgctaattcctgtcataaacaagctccaggacgtcttcaacacggtgggcgccgacatcatccagctgcctcaaatcgtcgtagtgggaacgcagagcagcggaaagagctcagtgctagaaagcctggtggggagggacctgcttcccagaggtactggaattgtcacccggagacctctcattctgcaactggtccatgtttcacaagaagataaacggaaaacaacaggagaagaaaatggggtggaagcagaagaatggggtaaatttcttcacaccaaaaataagctttacacggattttgatgaaattcgacaagaaattgaaaatgaaacagaaagaatttcaggaaataataagggagtaagccctgaaccaattcatcttaagattttttcacccaacgttgtcaatttgacacttgtggatttgccaggaatgaccaaggtgcctgtaggtgatcaacctaaggatattgagcttcaaatcagagagctcattcttcggttcatcagtaatcctaattccattatcctcgctgtcactgctgctaatacagatatggcaacatcagaggcacttaaaatttcaagagaggtagatccagatggtcgcagaaccctagctgtaatcactaaacttgatctcatggatgcgggtactgatgccatggatgtattgatgggaagggttattccagtcaaacttggaataattggagtagttaacaggagccagctagatattaacaacaagaagagtgtaactgattcaatccgtgatgagtatgcttttcttcaaaagaaatatccatctctggccaatagaaatggaacaaagtatcttgctaggactctaaacaggttactgatgcatcacatcagagattgtttaccagagttgaaaacaagaataaatgttctagctgctcagtatcagtctcttctaaatagctacggtgaacccgtggatgataaaagtgctactttactccaacttattaccaaatttgccacagaatattgtaacactattgaaggaactgcaaaatatattgaaacttcggagctatgcggtggtgctagaatttgttatattttccatgagacttttgggcgaaccttagaatctgttgatccacttggtggccttaacactattgacattttgactgccattagaaatgctactggtcctcgtcctgctttatttgtgcctgaggtttcatttgagttactggtgaagcggcaaatcaaacgtctagaagagcccagcctccgctgtgtggaactggttcatgaggaaatgcaaaggatcattcagcactgtagcaattacagtacacaggaattgttacgatttcctaaacttcatgatgccatagttgaagtggtgacttgtcttcttcgtaaaaggttgcctgttacaaatgaaatggtccataacttagtggcaattgaactggcttatatcaacacaaaacatccagactttgctgatgcttgtgggctaatgaacaataatatagaggaacaaaggagaaacaggctagccagagaattaccttcagctgtatcacgagacaagttaattcaggacagcagaagagaaactaaaaatgttgcatctggaggtggtggggttggagatggtgttcaagaaccaaccacaggcaactggagaggaatgctgaaaacttcaaaagctgaagagttattagcagaagaaaaatcaaaacccattccaattatgccagccagtccacaaaaaggtcatgccgtgaacctgctagatgtgccagttcctgttgcacgaaaactatctgctcgggaacagcgagattgtgaggttattgaacgactcattaaatcatattttctcattgtcagaaagaatattcaagacagtgtgccaaaggcagtaatgcattttttggttaatcatgtgaaagacactcttcagagtgagctagtaggccagctgtataaatcatccttattggatgatcttctgacagaatctgaggacatggcacagcgcaggaaagaagcagctgatatgctaaaggcattacaaggagccagtcaaattattgctgaaatccgggagactcatctttggtga
Sequence Length
2133
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
82,057 Da
NCBI Official Full Name
Homo sapiens dynamin 1-like, mRNA
NCBI Official Synonym Full Names
dynamin 1 like
NCBI Official Symbol
DNM1L
NCBI Official Synonym Symbols
DLP1; DRP1; DVLP; EMPF; EMPF1; DYMPLE; HDYNIV
NCBI Protein Information
dynamin-1-like protein
UniProt Protein Name
Dynamin-1-like protein
Protein Family
UniProt Gene Name
DNM1L
UniProt Synonym Gene Names
DLP1; DRP1; DVLP; Dymple; HdynIV
UniProt Entry Name
DNM1L_HUMAN

NCBI Description

This gene encodes a member of the dynamin superfamily of GTPases. The encoded protein mediates mitochondrial and peroxisomal division, and is involved in developmentally regulated apoptosis and programmed necrosis. Dysfunction of this gene is implicated in several neurological disorders, including Alzheimer's disease. Mutations in this gene are associated with the autosomal dominant disorder, encephalopathy, lethal, due to defective mitochondrial and peroxisomal fission (EMPF). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2013]

Uniprot Description

DRP1: Functions in mitochondrial and peroxisomal division. Mediates membrane fission through oligomerization into ring-like structures which wrap around the scission site to constict and sever the mitochondrial membrane through a GTP hydrolysis- dependent mechanism. Required for normal brain development. Facilitates developmentally-regulated apoptosis during neural tube development. Required for a normal rate of cytochrome c release and caspase activation during apoptosis. Also required for mitochondrial fission during mitosis. May be involved in vesicle transport. Homotetramer; dimerizes through the N-terminal GTP-middle region of one molecule binding to the GED domain of another DNM1L molecule. Can self-assemble in multimeric ring-like structures. Interacts with BCL2L1; the interaction stimulates the GTPase activity of DMN1L in synapses and increases the number of axonal mitochondria and the size and number of synaptic vesicle clusters. Interacts with FIS1. Interacts with GSK3B and MARCH5. Interacts (via the GTPase and B domains) with UBE2I; the interaction promotes sumoylation of DNM1L, mainly in ite B domain. Interacts with PPP3CA; the interaction dephosphorylates DNM1L and regulates its transition to mitochondria. Interacts witn MID49 and MID51. Ubiquitously expressed with highest levels found in skeletal muscles, heart, kidney and brain. Isoform 1 is brain-specific. Isoform 2 and isoform 3 are predominantly expressed in testis and skeletal muscles respectively. Isoform 4 is weakly expressed in brain, heart and kidney. Isoform 5 is dominantly expressed in liver, heart and kidney. Isoform 6 is expressed in neurons. Belongs to the dynamin family. 6 isoforms of the human protein are produced by alternative splicing.

Protein type: Apoptosis; EC 3.6.5.5; Endoplasmic reticulum; Hydrolase; Microtubule-binding; Mitochondrial; Motor

Chromosomal Location of Human Ortholog: 12p11.21

Cellular Component: cytoplasm; cytosol; endoplasmic reticulum; endoplasmic reticulum membrane; Golgi apparatus; intracellular membrane-bound organelle; membrane; microtubule; mitochondrial outer membrane; mitochondrion; perinuclear region of cytoplasm; peroxisome; protein complex

Molecular Function: GTP-dependent protein binding; GTPase activator activity; GTPase activity; microtubule binding; protein binding; protein homodimerization activity; Rab GTPase binding; ubiquitin protein ligase binding

Biological Process: cell structure disassembly during apoptosis; endoplasmic reticulum organization and biogenesis; intracellular distribution of mitochondria; mitochondrial fission; mitochondrial fragmentation during apoptosis; mitochondrion organization and biogenesis; peroxisome fission; positive regulation of apoptosis; positive regulation of protein secretion; protein homotetramerization; protein oligomerization; regulation of protein oligomerization; release of cytochrome c from mitochondria

Disease: Encephalopathy, Lethal, Due To Defective Mitochondrial And Peroxisomal Fission

Research Articles on DNM1L

Similar Products

Product Notes

The DNM1L dnm1l (Catalog #AAA1272929) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggcgc taattcctgt cataaacaag ctccaggacg tcttcaacac ggtgggcgcc gacatcatcc agctgcctca aatcgtcgta gtgggaacgc agagcagcgg aaagagctca gtgctagaaa gcctggtggg gagggacctg cttcccagag gtactggaat tgtcacccgg agacctctca ttctgcaact ggtccatgtt tcacaagaag ataaacggaa aacaacagga gaagaaaatg gggtggaagc agaagaatgg ggtaaatttc ttcacaccaa aaataagctt tacacggatt ttgatgaaat tcgacaagaa attgaaaatg aaacagaaag aatttcagga aataataagg gagtaagccc tgaaccaatt catcttaaga ttttttcacc caacgttgtc aatttgacac ttgtggattt gccaggaatg accaaggtgc ctgtaggtga tcaacctaag gatattgagc ttcaaatcag agagctcatt cttcggttca tcagtaatcc taattccatt atcctcgctg tcactgctgc taatacagat atggcaacat cagaggcact taaaatttca agagaggtag atccagatgg tcgcagaacc ctagctgtaa tcactaaact tgatctcatg gatgcgggta ctgatgccat ggatgtattg atgggaaggg ttattccagt caaacttgga ataattggag tagttaacag gagccagcta gatattaaca acaagaagag tgtaactgat tcaatccgtg atgagtatgc ttttcttcaa aagaaatatc catctctggc caatagaaat ggaacaaagt atcttgctag gactctaaac aggttactga tgcatcacat cagagattgt ttaccagagt tgaaaacaag aataaatgtt ctagctgctc agtatcagtc tcttctaaat agctacggtg aacccgtgga tgataaaagt gctactttac tccaacttat taccaaattt gccacagaat attgtaacac tattgaagga actgcaaaat atattgaaac ttcggagcta tgcggtggtg ctagaatttg ttatattttc catgagactt ttgggcgaac cttagaatct gttgatccac ttggtggcct taacactatt gacattttga ctgccattag aaatgctact ggtcctcgtc ctgctttatt tgtgcctgag gtttcatttg agttactggt gaagcggcaa atcaaacgtc tagaagagcc cagcctccgc tgtgtggaac tggttcatga ggaaatgcaa aggatcattc agcactgtag caattacagt acacaggaat tgttacgatt tcctaaactt catgatgcca tagttgaagt ggtgacttgt cttcttcgta aaaggttgcc tgttacaaat gaaatggtcc ataacttagt ggcaattgaa ctggcttata tcaacacaaa acatccagac tttgctgatg cttgtgggct aatgaacaat aatatagagg aacaaaggag aaacaggcta gccagagaat taccttcagc tgtatcacga gacaagttaa ttcaggacag cagaagagaa actaaaaatg ttgcatctgg aggtggtggg gttggagatg gtgttcaaga accaaccaca ggcaactgga gaggaatgct gaaaacttca aaagctgaag agttattagc agaagaaaaa tcaaaaccca ttccaattat gccagccagt ccacaaaaag gtcatgccgt gaacctgcta gatgtgccag ttcctgttgc acgaaaacta tctgctcggg aacagcgaga ttgtgaggtt attgaacgac tcattaaatc atattttctc attgtcagaa agaatattca agacagtgtg ccaaaggcag taatgcattt tttggttaat catgtgaaag acactcttca gagtgagcta gtaggccagc tgtataaatc atccttattg gatgatcttc tgacagaatc tgaggacatg gcacagcgca ggaaagaagc agctgatatg ctaaaggcat tacaaggagc cagtcaaatt attgctgaaa tccgggagac tcatctttgg tga. It is sometimes possible for the material contained within the vial of "DNM1L, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.