Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DND1 cdna clone

DND1 cDNA Clone

Gene Names
DND1; RBMS4
Synonyms
DND1; DND1 cDNA Clone; DND1 cdna clone
Ordering
For Research Use Only!
Sequence
atgcagtccaagcgggattgtgagctgtggtgtgagagggtgaatccagagaacaaggcggcgctggaggcgtgggtcagggagacaggcatccgcctggtgcaggtgaacgggcagaggaagtatggcgggccacccccaggctgggtgggcagcccgccgccagctgggtcagaggtgttcatcgggcggctgcctcaggacgtgtacgagcaccagcttatcccgctgttccagcgcgtgggccgcctctacgagttccgcctgatgatgaccttcagcggcctgaaccgcggcttcgcctatgcccgctacagctcgaggcgcggcgcgcaggccgccatcgccacgctgcacaaccatccgctgcggccgtcctgcccgctgctcgtgtgccgcagcaccgagaagtgtgagctgagcgttgacggcctgccgccgaatctgacccgcagcgcgctgctgctcgcgctgcagccgctgggtcccggcttgcaggaggcgcggctgctgcccagccccggaccggcgcccgggcagatcgctctgctcaaattcagctcgcaccgggccgctgccatggccaaaaaggccctggtggaagggcagtcacacctctgtggagagcaggtggctgtggagtggctcaagccagacctgaagcagcgacttcgccagcagcttgtgggtcccttcttgcggtccccacagccagagggcagccagttggctttggcaagggacaagttagggttccaaggggctcgggctaccctgcagttgctgtgccaacgaatgaagctgggcagccctgtgttcctcaccaagtgtttgggcataggacctgctggctggcaccgcttctggtaccaggtggtgattcctgggcatccggtgcccttcagcggcctcatctgggttgtgctgaccctagatggccgggatgggcatgaggtggccaaggatgctgtgtctgtacggctgctgcaggcactcagtgagtctggggccaacctcctgtggtctgctggggctgaggcaggtaccatggttaaacagtga
Sequence Length
1062
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
38,687 Da
NCBI Official Full Name
Homo sapiens dead end homolog 1 (zebrafish), mRNA
NCBI Official Synonym Full Names
DND microRNA-mediated repression inhibitor 1
NCBI Official Symbol
DND1
NCBI Official Synonym Symbols
RBMS4
NCBI Protein Information
dead end protein homolog 1
UniProt Protein Name
Dead end protein homolog 1
Protein Family
UniProt Gene Name
DND1
UniProt Synonym Gene Names
RBMS4
UniProt Entry Name
DND1_HUMAN

NCBI Description

This gene encodes a protein that binds to microRNA-targeting sequences of mRNAs, inhibiting microRNA-mediated repression. Reduced expression of this gene has been implicated in tongue squamous cell carcinoma. Two pseudogenes of this gene are located on the long arm of chromosome 17. [provided by RefSeq, Dec 2010]

Uniprot Description

DND1: RNA-binding factor that positively regulates gene expression by prohibiting miRNA-mediated gene suppression. Relieves miRNA repression in germline cells. Prohibits the function of several miRNAs by blocking the accessibility of target mRNAs. Sequence-specific RNA-binding factor that binds specifically to U-rich regions (URRs) in the 3' untranslated region (3'-UTR) of several mRNAs. Does not bind to miRNAs. May play a role during primordial germ cell (PGC) survival. However, does not seem to be essential for PGC migration.

Chromosomal Location of Human Ortholog: 5q31.3

Cellular Component: cytoplasm; nucleus

Molecular Function: AU-rich element binding; miRNA binding

Research Articles on DND1

Similar Products

Product Notes

The DND1 dnd1 (Catalog #AAA1272906) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcagtcca agcgggattg tgagctgtgg tgtgagaggg tgaatccaga gaacaaggcg gcgctggagg cgtgggtcag ggagacaggc atccgcctgg tgcaggtgaa cgggcagagg aagtatggcg ggccaccccc aggctgggtg ggcagcccgc cgccagctgg gtcagaggtg ttcatcgggc ggctgcctca ggacgtgtac gagcaccagc ttatcccgct gttccagcgc gtgggccgcc tctacgagtt ccgcctgatg atgaccttca gcggcctgaa ccgcggcttc gcctatgccc gctacagctc gaggcgcggc gcgcaggccg ccatcgccac gctgcacaac catccgctgc ggccgtcctg cccgctgctc gtgtgccgca gcaccgagaa gtgtgagctg agcgttgacg gcctgccgcc gaatctgacc cgcagcgcgc tgctgctcgc gctgcagccg ctgggtcccg gcttgcagga ggcgcggctg ctgcccagcc ccggaccggc gcccgggcag atcgctctgc tcaaattcag ctcgcaccgg gccgctgcca tggccaaaaa ggccctggtg gaagggcagt cacacctctg tggagagcag gtggctgtgg agtggctcaa gccagacctg aagcagcgac ttcgccagca gcttgtgggt cccttcttgc ggtccccaca gccagagggc agccagttgg ctttggcaag ggacaagtta gggttccaag gggctcgggc taccctgcag ttgctgtgcc aacgaatgaa gctgggcagc cctgtgttcc tcaccaagtg tttgggcata ggacctgctg gctggcaccg cttctggtac caggtggtga ttcctgggca tccggtgccc ttcagcggcc tcatctgggt tgtgctgacc ctagatggcc gggatgggca tgaggtggcc aaggatgctg tgtctgtacg gctgctgcag gcactcagtg agtctggggc caacctcctg tggtctgctg gggctgaggc aggtaccatg gttaaacagt ga. It is sometimes possible for the material contained within the vial of "DND1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.