Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DNAL4 cdna clone

DNAL4 cDNA Clone

Gene Names
DNAL4; MRMV3; PIG27
Synonyms
DNAL4; DNAL4 cDNA Clone; DNAL4 cdna clone
Ordering
For Research Use Only!
Sequence
atgggagaaacagaagggaagaaagatgaggctgactataagcgactgcagaccttccctctggtcaggcactcggacatgccagaggagatgcgcgtggagaccatggagctatgtgtcacagcctgtgagaaattctccaacaacaacgagagcgccgccaagatgatcaaagagacaatggacaagaagttcggctcctcctggcacgtggtgatcggcgagggctttgggtttgagatcacccacgaggtgaagaacctcctctacctgtacttcgggggcaccctggctgtgtgcgtctggaagtgctcctga
Sequence Length
318
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
12,009 Da
NCBI Official Full Name
Homo sapiens dynein, axonemal, light chain 4, mRNA
NCBI Official Synonym Full Names
dynein axonemal light chain 4
NCBI Official Symbol
DNAL4
NCBI Official Synonym Symbols
MRMV3; PIG27
NCBI Protein Information
dynein light chain 4, axonemal
UniProt Protein Name
Dynein light chain 4, axonemal
Protein Family
UniProt Gene Name
DNAL4
UniProt Entry Name
DNAL4_HUMAN

NCBI Description

This gene encodes an axonemal dynein light chain which functions as a component of the outer dynein arms complex. This complex acts as the molecular motor that provides the force to move cilia in an ATP-dependent manner. The encoded protein is expressed in tissues with motile cilia or flagella and may be involved in the movement of sperm flagella. [provided by RefSeq, Dec 2014]

Uniprot Description

DNAL4: Force generating protein of respiratory cilia. Produces force towards the minus ends of microtubules. Dynein has ATPase activity. Belongs to the dynein light chain family.

Chromosomal Location of Human Ortholog: 22q13.1

Cellular Component: plasma membrane

Molecular Function: microtubule motor activity; protein binding

Biological Process: microtubule-based movement

Disease: Mirror Movements 3

Research Articles on DNAL4

Similar Products

Product Notes

The DNAL4 dnal4 (Catalog #AAA1268248) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggagaaa cagaagggaa gaaagatgag gctgactata agcgactgca gaccttccct ctggtcaggc actcggacat gccagaggag atgcgcgtgg agaccatgga gctatgtgtc acagcctgtg agaaattctc caacaacaac gagagcgccg ccaagatgat caaagagaca atggacaaga agttcggctc ctcctggcac gtggtgatcg gcgagggctt tgggtttgag atcacccacg aggtgaagaa cctcctctac ctgtacttcg ggggcaccct ggctgtgtgc gtctggaagt gctcctga. It is sometimes possible for the material contained within the vial of "DNAL4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.