DNAJC4 cdna clone
DNAJC4 cDNA Clone
Gene Names
DNAJC4; HSPF2; MCG18; DANJC4
Synonyms
DNAJC4; DNAJC4 cDNA Clone; DNAJC4 cdna clone
Sequence
atgccgcccttactgcccctgcgcctgtgccggctgtggccccgcaaccctccctcccggctcctcggagcggccgccgggcagcggtccagacccagtacttattatgaactgttgggggtgcatcctggtgccagcactgaggaagttaaacgagctttcttctccaagtccaaagagctgcacccagaccgggaccctgggaacccaagcctgcacagccgctttgtggagctgagcgaggcataccgtgtgctcagccgtgagcagagccgccgcagctatgatgaccagctccgctcaggtagtcccccaaagtctccacgaaccacagtccatgacaagtctgcccaccaaacacacagctcctggacaccccccaacgcacagtactggtcccagtttcacagcgtgaggccacaggggccccagttgaggcagcagcaacacaaacaaaacaaacaagtgctggggtactgcctcctcctcatgctggcgggcatgggcctgcactacattgccttcaggaaggtgaagcagatgcaccttaacttcatggatgaaaaggatcggatcatcacagccttctacaacgaagcccgggcacgggccagggccaacagaggcatccttcagcaggagcgacaacggctagggcagcggcagccgccaccatccgagccaacccaaggccccgagatcgtgccccggggcgccggcccctga
Sequence Length
726
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
27,593 Da
NCBI Official Full Name
Homo sapiens DnaJ (Hsp40) homolog, subfamily C, member 4, mRNA
NCBI Official Synonym Full Names
DnaJ heat shock protein family (Hsp40) member C4
NCBI Official Symbol
DNAJC4
NCBI Official Synonym Symbols
HSPF2; MCG18; DANJC4
NCBI Protein Information
dnaJ homolog subfamily C member 4
UniProt Protein Name
DnaJ homolog subfamily C member 4
Protein Family
UniProt Gene Name
DNAJC4
UniProt Synonym Gene Names
HSPF2; MCG18
UniProt Entry Name
DNJC4_HUMAN
Uniprot Description
DNAJC4:
Protein type: Mitochondrial; Chaperone; Membrane protein, integral
Chromosomal Location of Human Ortholog: 11q13
Molecular Function: protein binding
Biological Process: response to unfolded protein
Research Articles on DNAJC4
Similar Products
Product Notes
The DNAJC4 dnajc4 (Catalog #AAA1270223) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccgccct tactgcccct gcgcctgtgc cggctgtggc cccgcaaccc tccctcccgg ctcctcggag cggccgccgg gcagcggtcc agacccagta cttattatga actgttgggg gtgcatcctg gtgccagcac tgaggaagtt aaacgagctt tcttctccaa gtccaaagag ctgcacccag accgggaccc tgggaaccca agcctgcaca gccgctttgt ggagctgagc gaggcatacc gtgtgctcag ccgtgagcag agccgccgca gctatgatga ccagctccgc tcaggtagtc ccccaaagtc tccacgaacc acagtccatg acaagtctgc ccaccaaaca cacagctcct ggacaccccc caacgcacag tactggtccc agtttcacag cgtgaggcca caggggcccc agttgaggca gcagcaacac aaacaaaaca aacaagtgct ggggtactgc ctcctcctca tgctggcggg catgggcctg cactacattg ccttcaggaa ggtgaagcag atgcacctta acttcatgga tgaaaaggat cggatcatca cagccttcta caacgaagcc cgggcacggg ccagggccaa cagaggcatc cttcagcagg agcgacaacg gctagggcag cggcagccgc caccatccga gccaacccaa ggccccgaga tcgtgccccg gggcgccggc ccctga. It is sometimes possible for the material contained within the vial of "DNAJC4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
