Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DNAJC28 cdna clone

DNAJC28 cDNA Clone

Gene Names
DNAJC28; C21orf55; C21orf78
Synonyms
DNAJC28; DNAJC28 cDNA Clone; DNAJC28 cdna clone
Ordering
For Research Use Only!
Sequence
atgaatacaatgtatgtgatgatggctcagatcttaagatctcacctgataaaggctacagtgattcctaatcgagtgaaaatgcttccatattttggtatcattagaaatagaatgatgtcaacccataaatccaaaaagaagatcagagaatattatagactgctgaacgtggaggaaggatgctctgcagatgaagtcagggaatcttttcataagcttgccaagcaatatcatcctgacagtggctctaatactgctgattctgcaacatttataaggattgaaaaagcttatagaaaggtgctctcccatgtgatagaacaaacaaatgccagtcagagtaaaggtgaagaagaagaagatgtagaaaaattcaaatataaaacaccccaacaccgacattatttaagttttgaaggtattggttttgggactccaactcaacgagagaagcattataggcaatttagggcagaccgtgctgctgaacaagtgatggaatatcaaaagcagaaactacaaagccagtattttcctgatagtgtaattgttaaaaatataagacagagcaaacagcaaaagataacgcaagctatagaacgtttagtggaggacctcattcaagaatccatggcaaaaggagactttgacaatctcagtgggaaaggaaaacgtctgaaaaagttttctgactgttcttacattgatcccatgactcacaacctgaaccgaatactgatcgataatggataccaaccagaatggatccttaagcaaaaggaaataagcgatactattgagcaactcagagaggcaattttagtgtctaggaaaaaacttgggaatccaatgacaccaactgaaaagaaacagtggaaccatgtttgtgagcagtttcaagaaaacatcagaaaattaaacaagcgaattaatgattttaattgttcccatcctgaccaggcaaaaagtccattttga
Sequence Length
981
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
45,806 Da
NCBI Official Full Name
Homo sapiens chromosome 21 open reading frame 55, mRNA
NCBI Official Synonym Full Names
DnaJ heat shock protein family (Hsp40) member C28
NCBI Official Symbol
DNAJC28
NCBI Official Synonym Symbols
C21orf55; C21orf78
NCBI Protein Information
dnaJ homolog subfamily C member 28
UniProt Protein Name
DnaJ homolog subfamily C member 28
Protein Family
UniProt Gene Name
DNAJC28
UniProt Synonym Gene Names
C21orf55; C21orf78
UniProt Entry Name
DJC28_HUMAN

Uniprot Description

DNAJC28: May have a role in protein folding or as a chaperone.

Protein type: Unknown function

Chromosomal Location of Human Ortholog: 21q22.11

Cellular Component: Golgi transport complex

Molecular Function: protein binding

Biological Process: Golgi organization and biogenesis; Golgi vesicle prefusion complex stabilization; retrograde transport, vesicle recycling within Golgi; retrograde vesicle-mediated transport, Golgi to ER

Similar Products

Product Notes

The DNAJC28 dnajc28 (Catalog #AAA1274336) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaatacaa tgtatgtgat gatggctcag atcttaagat ctcacctgat aaaggctaca gtgattccta atcgagtgaa aatgcttcca tattttggta tcattagaaa tagaatgatg tcaacccata aatccaaaaa gaagatcaga gaatattata gactgctgaa cgtggaggaa ggatgctctg cagatgaagt cagggaatct tttcataagc ttgccaagca atatcatcct gacagtggct ctaatactgc tgattctgca acatttataa ggattgaaaa agcttataga aaggtgctct cccatgtgat agaacaaaca aatgccagtc agagtaaagg tgaagaagaa gaagatgtag aaaaattcaa atataaaaca ccccaacacc gacattattt aagttttgaa ggtattggtt ttgggactcc aactcaacga gagaagcatt ataggcaatt tagggcagac cgtgctgctg aacaagtgat ggaatatcaa aagcagaaac tacaaagcca gtattttcct gatagtgtaa ttgttaaaaa tataagacag agcaaacagc aaaagataac gcaagctata gaacgtttag tggaggacct cattcaagaa tccatggcaa aaggagactt tgacaatctc agtgggaaag gaaaacgtct gaaaaagttt tctgactgtt cttacattga tcccatgact cacaacctga accgaatact gatcgataat ggataccaac cagaatggat ccttaagcaa aaggaaataa gcgatactat tgagcaactc agagaggcaa ttttagtgtc taggaaaaaa cttgggaatc caatgacacc aactgaaaag aaacagtgga accatgtttg tgagcagttt caagaaaaca tcagaaaatt aaacaagcga attaatgatt ttaattgttc ccatcctgac caggcaaaaa gtccattttg a. It is sometimes possible for the material contained within the vial of "DNAJC28, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.