Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DNAJC24 cdna clone

DNAJC24 cDNA Clone

Gene Names
DNAJC24; DPH4; JJJ3; ZCSL3
Synonyms
DNAJC24; DNAJC24 cDNA Clone; DNAJC24 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggttgagcagatgccaaaaaaggattggtacagcatcctgggagcagacccatctgcaaatatatcagacctaaaacaaaaatatcaaaaactcatattaatgtatcatccagataaacaaagtacagatgtaccagcaggaacagtggaggaatgtgtacagaagttcatcgaaattgatcaagcatggaaaattctaggaaatgaagagacaaaaagagagtatgacctgcagcggtgtgaagatgatctaagaaatgtaggaccagtagatgctcaagtatatcttgaagaaatgtcttggaatgaaggtgatcactctttttatctgagttgcagatgtggtggaaaatacagtgtttccaaggatgaagcggaagaagttagcctgatttcttgtgatacatgttcactaattatagaactccttcattataactaa
Sequence Length
447
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
9,693 Da
NCBI Official Full Name
Homo sapiens DnaJ (Hsp40) homolog, subfamily C, member 24, mRNA
NCBI Official Synonym Full Names
DnaJ heat shock protein family (Hsp40) member C24
NCBI Official Symbol
DNAJC24
NCBI Official Synonym Symbols
DPH4; JJJ3; ZCSL3
NCBI Protein Information
dnaJ homolog subfamily C member 24
UniProt Protein Name
DnaJ homolog subfamily C member 24
Protein Family
UniProt Gene Name
DNAJC24
UniProt Synonym Gene Names
DPH4; ZCSL3
UniProt Entry Name
DJC24_HUMAN

NCBI Description

Diphthamide is a unique posttranslationally modified histidine found only in translation elongation factor-2 (EEF2; MIM 130610). This modification is conserved from archaebacteria to humans and serves as the target for ADP-ribosylation and inactivation of EEF2 by diphtheria toxin (DT) and Pseudomonas exotoxin A. DPH4 is 1 of several enzymes involved in synthesis of diphthamide in EEF2 (Liu et al., 2004 [PubMed 15485916]).[supplied by OMIM, Mar 2008]

Uniprot Description

DNAJC24: Stimulates the ATPase activity of several Hsp70-type chaperones. Belongs to the DPH4 family.

Protein type: Enzyme, misc.; Chaperone

Chromosomal Location of Human Ortholog: 11p13

Molecular Function: ATPase activator activity; ferrous iron binding; zinc ion binding

Biological Process: positive regulation of ATPase activity

Research Articles on DNAJC24

Similar Products

Product Notes

The DNAJC24 dnajc24 (Catalog #AAA1277685) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggttg agcagatgcc aaaaaaggat tggtacagca tcctgggagc agacccatct gcaaatatat cagacctaaa acaaaaatat caaaaactca tattaatgta tcatccagat aaacaaagta cagatgtacc agcaggaaca gtggaggaat gtgtacagaa gttcatcgaa attgatcaag catggaaaat tctaggaaat gaagagacaa aaagagagta tgacctgcag cggtgtgaag atgatctaag aaatgtagga ccagtagatg ctcaagtata tcttgaagaa atgtcttgga atgaaggtga tcactctttt tatctgagtt gcagatgtgg tggaaaatac agtgtttcca aggatgaagc ggaagaagtt agcctgattt cttgtgatac atgttcacta attatagaac tccttcatta taactaa. It is sometimes possible for the material contained within the vial of "DNAJC24, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.